Recent activity by Mir Mahfuz

Question

Drag the tiles to the boxes to form correct pairs. Match the drug with its mode of action. suppresses or blocks the cough reflex relaxes the bronchial muscles 101 bronchodilators antitussive decongestant

answered Dec 29, 2024

1 answer 192k views

An observer in a lighthouse 350 feet above sea level observes two ships directly offshore. The angles of depression to the ships are β = 6° and θ = 10.5° (see figure). How far apart are the ships? (Round

answered Dec 3, 2024

1 answer 210k views

Building an appropriate protein matrix is essential for achieving the proper quality features in baked goods. Increasing the amount of sugar in a recipe will have which of the following effects on gluten

asked Nov 13, 2024

1 answer 115k views

1. Using the line of nucleic bases provided complete the complimentary DNA base pair strand? TATCGAGCCGTATGACGATGAACGAATTCCTAA 2. How many base pairings did you make? 3. Using the line of DNA nucleic bases

asked Sep 22, 2024

1 answer 104k views

QN=1 Companies facing the challenge of setting prices for the first time can choose between two broad strategies: market-penetration pricing and ________. a. market-level pricing b. market-competitive

answered Sep 10, 2024

1 answer 35.9k views

Is the length of a story in pages (p) dependent or independent of the number of words (w) in the story? a) Dependent b) Independent

asked Sep 2, 2024

1 answer 103k views

Which of the following explains why the inflation rate is slow to adjust over time? A) Sticky prices and wages. B) Flexible prices and wages. C) Constant money supply. D) Inelastic demand.

asked Aug 21, 2024

1 answer 44.2k views

A ____________ is the least polluting, least costly, and most efficient means of converting the potential energy of water into electrical energy. a) Hydroelectric dam b) Tidal turbine c) Wind turbine d)

answered Jun 24, 2024

1 answer 152k views

After emancipation, what did freedom mean to former slaves in terms of their work, family, religion, and education?

asked Jun 19, 2024

1 answer 28.5k views

When did regionalism in material culture emerge, and why is it significant?

asked Mar 20, 2024

1 answer 122k views

Which of the following are examples of thematic development? a. syncopating the rhythm of the theme b. altering the harmony underneath the theme c. altering the melodic outline of the theme d. substituting

answered Mar 7, 2024

1 answer 55.0k views

What mass of amoniuim chloride is dissolved in 300 ml of a 0.875 m solution

asked Mar 1, 2024

1 answer 169k views

A nurse performs an assessment of a client in a long-term care facility and records baseline data. The nurse reassesses the client a month later and makes revisions in the plan of care. What type of assessment

answered Feb 21, 2024

1 answer 80.8k views

A 30-kg iron block and a 40-kg copper block, both initially at 80⁰c, are dropped into a large lake at 15⁰c. thermal equilibrium is established after a while because of heat transfer between the blocks

asked Feb 4, 2024

1 answer 132k views

alket goes to school on foot, when he walks 1/3 of the way, it is 7:40, while when he has walked 1/2, it is 7:45. At what time did alket reach school

asked Jan 14, 2024

1 answer 234k views

The famous Roman ___________ were a series of pools that went from hot water to cold. A) Aqueducts B) Baths C) Villas D) Forums

asked Jan 12, 2024

1 answer 27.2k views

English 9 Checkpoint 2 - Part 1 Answers

answered Nov 25, 2023

1 answer 57.3k views

Assume that you have an unhealthy relationship with someone. Who are people you think could help you to deal with this relationship? Explain.

asked Nov 10, 2023

1 answer 16.0k views

Which expression is the factorization of x2 + 10x + 21? (x + 3)(x + 7) (x + 4)(x + 6) (x + 6)(x + 15) (x + 7)(x + 14)\

asked Oct 3, 2023

2 answers 26.9k views

Given f(x), find g(x) and h(x) such that f(x)= g(h(x)) and neither g(x) nor h(x) is solely x.

answered Jul 24, 2023

1 answer 12.9k views

Ask a Question