Recent activity by Mazze

Recent activity by Mazze

In a cell replicating the DNA fragment of Figure 7, the non-coding strand (II) is used as a template for the synthesis of the coding strand (I).5 AAAAAAATGGTGCACCTTACGCCAGAGGAG 3¹ (1) 3 TTTTTTTACCACGTGGAATGCGGTCTCCT

answered Nov 13, 2023

1 answer 166k views

Use the following image to answer the question. Which of the following sections represents a federal court that would hear cases for the first time? E A F B

asked Oct 26, 2023

2 answers 216k views

9. Farah buys 2 pens at 84p each 3 folders at £1.35 each 1 pencil case at £1.49 She pays with a £10 note. Work out how much change Farah should get from £10.

answered Oct 22, 2023

1 answer 223k views

This is the most important idea of a reading passage or presentation.

asked Aug 25, 2023

1 answer 397k views

Two lines are shown on the grid below.Read the statements below about the graph of the two lines.Which statements are true about the two lines on the graph?A.I,II, and IV onlyB.II,III, and IV onlyC.II

asked Aug 16, 2023

1 answer 47.5k views

Determine if the solution set for the system of equations shown is the empty set, contains one point or is infinite. x + y = 4 x - y = 0

asked Aug 6, 2023

1 answer 114k views

consider the expressions 3x + 12; 3x + 4; x + 12; 12+ 3x which of the expressions would give a different answer than 3(x + 4) when x = 2

asked Jul 8, 2023

1 answer 497k views

How did the Ten Commandments compare to Hammurabi's Code?

asked May 8, 2023

2 answers 178k views

the graph of f(x) shown below has the same shape as the graph of g(x)=x^4-x^2 which contains the point

asked Mar 11, 2023

1 answer 401k views

How to solve this 75,465(7)

answered Feb 28, 2023

2 answers 399k views

A rectangular prism has a volume of 60 cubed inches. The length of the prism is 4in and the width is 3in. What is the height? Use V=LWH to solve. Show your work.

answered Nov 19, 2022

1 answer 247k views

A school custodian discovered a leak in a water pipe. the custodian found that 1,920 fluid ounces of water had leaked out. How many gallons of water is this? Use the conversion factor : 1 gallon over 128

asked Oct 25, 2022

1 answer 155k views

Can someone help me asap pls

answered Sep 19, 2022

1 answer 371k views

A thesis must be controversial and have two sides. True False

answered Jul 15, 2022

2 answers 116k views

At which World War II conference was the decision made by the Allies to divide Germany and Berlin after the war? A. Casablanca B. Geneva C. Iran D. Yalta grrr i thought it was potsdam but thats not an

asked May 4, 2022

2 answers 244k views

A bond that pays interest semiannually has a price of $941.35 and a semiannual coupon payment of $26.00. If the par value is $1,000, what is the current yield

asked Feb 22, 2022

1 answer 25.0k views

Can someone reword this big time plz The Giver views the decision makers in the community negatively. During his interaction with Jonas, he expresses some doubt and critique of their decisionmaking abilities

answered Jan 22, 2022

1 answer 262k views

Search QAmmunity.org