Recent activity by Marc Charbonneau

Recent activity by Marc Charbonneau

1liters of rain fell in the afternoon.3At Karen's house, liters of rain fell in the morning. Then10What was the total amount of rain that fell?10Write your answer as a fraction in simplest form.

asked Dec 16, 2023

1 answer 228k views

How would I solve this problem?

asked Nov 25, 2023

1 answer 116k views

Name and Describe three forms of evidence of the Theory of Evolution. If you simply list three forms of evidence and do not detail more about them or why they are important to supporting the theory of

answered Oct 8, 2023

1 answer 78.0k views

11. Find the equation of the line that goes through the points (4, 4) and (8, 6).

asked Oct 1, 2023

1 answer 1.2k views

A baby is bitten by a dog and then is afraid of all small animals. this is an example of _____.

answered Aug 17, 2023

1 answer 126k views

How many apples could you buy if you went to the store with five dollars? *

answered May 9, 2023

2 answers 152k views

Which of the following was NOT an effect from the War of 1812? A. the British blockade forced U.S. industry to strengthen and develop B. Great Britain was forced to leave North America C. the Indian alliance

answered Feb 24, 2023

2 answers 73.0k views

1. Peter _____ not French. a. am b. are c. were d. is

asked Feb 13, 2023

2 answers 18.3k views

Why is it most logical to let x represent Dianna’s current age?

asked Jan 19, 2023

2 answers 175k views

Populations of organisms that reproduce asxually tend to show less variation from one individual to another.Why might this be?

answered Jan 12, 2023

2 answers 127k views

Fiber art focuses on how useful the piece is. O True O False

answered Nov 21, 2022

2 answers 182k views

What are the chances a heterozygote passes on either a dominant or recessive allele?

asked Oct 6, 2022

1 answer 20.1k views

Solve the equation 1/x + 1/3x =4

answered Sep 16, 2022

2 answers 145k views

Estimate the sum of 872 and 121 by rounding both values to the nearest hundred. What is the best estimate of the sum?

asked Aug 18, 2022

1 answer 69.2k views

What do the signs need to be to multiply to get a positive and add to get a negative ?

asked Aug 1, 2022

1 answer 159k views

If Grouper refinances the obligation by issuing a long-term note on February 20, 2018 and using the proceeds to pay off the note due January 31, how much of the $1,720,000 should be reported as a current

asked Jul 18, 2022

1 answer 19.1k views

The atomic number of krypton (Kr) is 36, and its mass number is 84. How many neutrons does It have? O A 18 OB 36 Oc. 48 OD 72

answered Jul 17, 2022

2 answers 133k views

2. You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’. template DNA 3’ CCTACGGTTCGTACCCCGTATGTGTAACTTGTCAT 5’

answered Jun 27, 2022

1 answer 114k views

Options: A. the water level started at 40mL B. The change in the amount of water over time has a negative slope C. The water was gone by the eighth day D. The amount of water in the beaker decreased by

answered Jun 15, 2022

2 answers 51.8k views

A firm is choosing between two machines. Machine X has a first cost of $5,000 and a useful life of 5 years. Machine Y has a first cost of $8,000; useful life of 12 years; salvage value of $2,000; maintenance

answered Apr 28, 2022

1 answer 23.0k views

Search QAmmunity.org