Recent activity by Kelvin Kantaria

Recent activity by Kelvin Kantaria

6+3b= -18 lwuiehyfudsiufhcd

asked Nov 26, 2023

1 answer 84.6k views

A system of equations is shown below. Which ordered pair represent the solution to this system of equations?3x+2y=12y=x+1A. (2, 3)B. (2.2, 3.2)C. (3, 2)D. (4, 0)

answered Nov 8, 2023

1 answer 97.6k views

A sealed vessel containing sulfur dioxideand nitrogen has a total pressure of 520Torr and partial pressures of 266 Torrnitrogen.What is the partial pressure of sulfurdioxide in Torr?

answered Aug 29, 2023

1 answer 218k views

Item 15 What poem by William Blake claimed that the Industrial Revolution had replaced England’s “green and pleasant land” with “Satanic mills?” “Liberty Leading the People” “The Sorrows of Young Werther”

answered Aug 19, 2023

1 answer 143k views

which is not a step in the rock cycle? rocks at earth’s surface are broken down into smaller pieces. magma or lava cools. sediments melt deep beneath earth’s surface.

answered Jul 29, 2023

1 answer 57.0k views

I need help on the question in the picture attached. i tried posting it but no one is answering it and this was due last week. please help fast

answered Jul 14, 2023

1 answer 228k views

What was the first country that formed a coalition to supply unemployment benefits to its citizens?

asked Jun 22, 2023

2 answers 74.2k views

Guys please help me I really need help I need to turn this in tomorrow

answered May 9, 2023

1 answer 117k views

1.Give one example of an input 2.Give one example of an output 3. Why are those examples inputs and outputs?

answered Jan 16, 2023

2 answers 23.9k views

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT

answered Dec 1, 2022

1 answer 163k views

A qué acción se le conoce como cocción

answered Oct 6, 2022

2 answers 15.3k views

At which value in the domain does f(x) = 0? 2 2 4

asked Aug 8, 2022

1 answer 29.8k views

In rectangle PQRS, SP = 3 and RS = 4. What is the length of PR? (Hint: use the Pythagorean theorem to solve for the diagonal) *

answered Jul 25, 2022

1 answer 12.4k views

How is your mental health?? How did the rona change your life

answered Jul 22, 2022

2 answers 148k views

Holsen wants to know the theoretical and experimental probability of rolling a number larger than a 3 on a 6-sided number cube numbered 1 to 6. He rolls the number cube 6 times and records the results

asked Jul 6, 2022

1 answer 233k views

I know i have been asking alot of questions today but i really need your help

answered Jun 21, 2022

2 answers 24.7k views

Please help asap! I dont get it find the equation of the line that is perpendicular

answered Jun 21, 2022

1 answer 25.6k views

Im solving variables -4y + 7 = -10y+37

answered Apr 14, 2022

2 answers 214k views

Who built on their work issac Newton

asked Mar 19, 2022

1 answer 21.4k views

For brainily please help :/

asked Mar 12, 2022

1 answer 80.8k views

Search QAmmunity.org