Recent activity by Joshua Green

Recent activity by Joshua Green

Can someone help me with my fractions they are hard.

asked Nov 10, 2023

1 answer 63.5k views

The mRNA produced by the transcription of a gene encoding an oligopeptide is: 5 'AAAUGAAACCAGGAUAAGAAUU3' while the peptide produced by the translation of the above mRNA is: H2N-methionine-lysine-proline-glycine-COOH

asked Oct 23, 2023

1 answer 333k views

Y=5/x. Make x the subject of the formula

answered Oct 8, 2023

2 answers 32.9k views

Determine which of the following triples is not a right triangle. Select all that apply. 90, 215, 243 60, 144, 156 40, 75, 85 20,22,29 33,56,65

asked Jul 24, 2023

1 answer 521k views

how fast do i have to go from b to c in order to average for the whole trip? write an equation expressing v2 (the speed i need to average going from b to c) in terms of the other symbols given: v1, δl1,

answered May 19, 2023

1 answer 280k views

You can improve your gas mileage by your car before you drive.

asked Apr 6, 2023

1 answer 257k views

Car A Car B Car C 500 miles on 33.4 gallons 43 miles on 2.5 gallons 100 miles on 5.5 gallons Which car among the 3 had the best gas mileage?

answered Feb 1, 2023

1 answer 449k views

What fraction is equal to 75% of 1/2

asked Jan 24, 2023

2 answers 22.4k views

Find the volume of the rectangular prism. 8 cm 10 cm 2 cm 10 cm OA. 160.5 cm³ B. 182.4 cm³ Oc. 181.4 cm³ D. 160 cm³ 2 cm

asked Jan 13, 2023

1 answer 163k views

Noah randomly selects one of his eight different pairs of shoes to wear each day. Of his eight pairs of shoes, Noah has two pairs of boots and one pair of loafers. For how many days of the next 264 is

answered Nov 18, 2022

1 answer 351k views

How many different size triangles can be drawn with angle measures 90° , 45° , and 45°? No trinalges Exactly one triangle Exactly two triangles Any number of triangles

answered Oct 31, 2022

1 answer 43.4k views

Sarah planned to exercise on Monday morning, however, when her alarm clock rang she decided to sleep in and did not end up exercising. In this case, exercise ended up being:

asked Sep 1, 2022

1 answer 72.0k views

In an experiment to determine the acceleration due to gravity, one student holds a pencil at arm’s length and drops it. Another student starts a timer when the first student lets go and stops the timer

asked Jun 27, 2022

1 answer 417k views

Solve for a. 15-a/12=22

asked Jan 24, 2022

1 answer 239k views

Why have the atlantic revolutions been described as democratic revolutions?

asked Jan 17, 2022

1 answer 342k views

Search QAmmunity.org