Recent activity by Joe The Person

Recent activity by Joe The Person

Select the correct answer. What effect did the introduction of smallpox have in the Americas? A. It allowed Native Americans to quickly develop resistance to European diseases. B. It contributed to the

answered Dec 16, 2023

2 answers 116k views

Quinn's Cupcake shop has a price elasticity of supply of 3.75. Which of the following statements is the correct interpretation of this price elasticity of supply?

asked Sep 10, 2023

2 answers 26.2k views

Please help this is a emergency!

asked Sep 3, 2023

2 answers 104k views

Find the sum -8+(4) using a number line model

asked Aug 16, 2023

1 answer 115k views

Please Help!!!!!!!!!!! Put on your chef hat and grab your play money—you are going shopping for dinner. Read the ingredient list below. Then get an adult to take you to your local grocery store. You can

answered Jul 9, 2023

2 answers 72.8k views

Domain and range for y=x^2+5x-6

answered Jun 25, 2023

1 answer 3.3k views

Why was it harder for beowulf to kill grendel's mother.

answered Apr 8, 2023

1 answer 124k views

It takes an older computer 4 times as long to send out a company’s email as it does a newer computer. Working together, it takes the two computers 12 minutes to send out the email. How long will it take

answered Feb 16, 2023

1 answer 147k views

(2 Question 6 Without modifying the apparatus, how could the reliability of the results be increased?

answered Jan 8, 2023

1 answer 127k views

If you rub a glass rod with a piece of silk, the rod becomes positively charged. This means that Protons have moved to the rod Friction destroyed the electrons in the rod The silk has become negatively

answered Jan 1, 2023

1 answer 89.1k views

Which sentence uses the homophone "there" correctly? A. My friends shared there popcorn with me. B. One of my friends promised to give me a ride there. C. They promised to tell me about the next movie

asked Dec 6, 2022

2 answers 193k views

What is a trend in business

answered Dec 4, 2022

1 answer 8.8k views

3. A person is pushing a box down the hallway with a force of 25N. The Force of friction is 15N a. List all of the forces on the box (use pushing/pulling on

answered Nov 26, 2022

1 answer 49.6k views

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT

asked Nov 25, 2022

1 answer 163k views

A) Qué sectores establecen una "alianza" a partir de la lectura de Lugones? b) ¿Cuáles serían los beneficios de esta alianza para esos sectores? c) Rama también señala que Lugones hizo de la obra una "pie-

asked Aug 28, 2022

1 answer 199k views

Which of the following is not a reason that most work in the congress is down in committees? A) committed allow members to specialize in certain areas of policy. B) it is mandated by the constitution in

asked Aug 17, 2022

2 answers 23.6k views

What is the value of n^-4 w^0 for n=-2 and w=5?

answered Jul 27, 2022

1 answer 182k views

What are the 2 jobs of DNA polymerase?

answered Jul 13, 2022

2 answers 204k views

7-6: Practice Buddy: Independent Practice; Problem Solving help please!

answered May 12, 2022

2 answers 167k views

the height of an equivalent triangle is 15cm and it's perimeter is 36cm find the area of the triangle

asked Mar 22, 2022

1 answer 3.4k views

Search QAmmunity.org