Recent activity by Joe The Person

Question

Marisol spent 34.5 hours on her science project. She worked 1.5 hours each day on her project. How many days did Marisol work on her science project?

answered Aug 14, 2024

1 answer 146k views

First, discuss the anatomical differences between Paleocene pro-primates and Eocene eu-primates and explain those differences in the context of the three hypotheses for why primates emerged. Secondly,

answered Apr 27, 2024

1 answer 215k views

Which is a basic funcional group that can accept H+ and become positively charged? A) CH ₃ B) OH C) NH₂ D) COOH

asked Apr 21, 2024

1 answer 213k views

Once evacuated from Buna, the prisoners are forced to run a great distance in the snow. A young, Polish man called Zalman is running beside Eliezer during the march. As they are running, what happens to

asked Apr 20, 2024

1 answer 19.1k views

Your school has decided to do away with the fine arts program. You have decided to research the benefits of a fine arts program in schools. Who will you share this information with? O Your brother O Your

answered Feb 1, 2024

1 answer 182k views

In some situations where the regression model is useful, it is known that the mean of Y when X = 0 is equal to 0, i.e., Yi= ßXi + Ei where Ei for i = 1,2,...,n are independent and N(O, 02). (a) Obtain

asked Jan 1, 2024

1 answer 25.7k views

Select the correct answer. What effect did the introduction of smallpox have in the Americas? A. It allowed Native Americans to quickly develop resistance to European diseases. B. It contributed to the

answered Dec 16, 2023

2 answers 116k views

Quinn's Cupcake shop has a price elasticity of supply of 3.75. Which of the following statements is the correct interpretation of this price elasticity of supply?

asked Sep 10, 2023

2 answers 26.2k views

Please help this is a emergency!

asked Sep 3, 2023

2 answers 104k views

Find the sum -8+(4) using a number line model

asked Aug 16, 2023

1 answer 115k views

Please Help!!!!!!!!!!! Put on your chef hat and grab your play money—you are going shopping for dinner. Read the ingredient list below. Then get an adult to take you to your local grocery store. You can

answered Jul 9, 2023

2 answers 72.8k views

Domain and range for y=x^2+5x-6

answered Jun 25, 2023

1 answer 3.3k views

Why was it harder for beowulf to kill grendel's mother.

answered Apr 8, 2023

1 answer 124k views

It takes an older computer 4 times as long to send out a company’s email as it does a newer computer. Working together, it takes the two computers 12 minutes to send out the email. How long will it take

answered Feb 16, 2023

1 answer 147k views

(2 Question 6 Without modifying the apparatus, how could the reliability of the results be increased?

answered Jan 8, 2023

1 answer 127k views

If you rub a glass rod with a piece of silk, the rod becomes positively charged. This means that Protons have moved to the rod Friction destroyed the electrons in the rod The silk has become negatively

answered Jan 1, 2023

1 answer 89.1k views

Which sentence uses the homophone "there" correctly? A. My friends shared there popcorn with me. B. One of my friends promised to give me a ride there. C. They promised to tell me about the next movie

asked Dec 6, 2022

2 answers 193k views

What is a trend in business

answered Dec 4, 2022

1 answer 8.8k views

3. A person is pushing a box down the hallway with a force of 25N. The Force of friction is 15N a. List all of the forces on the box (use pushing/pulling on

answered Nov 26, 2022

1 answer 49.6k views

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT

asked Nov 25, 2022

1 answer 163k views

Ask a Question