Recent activity by JBernardo

Recent activity by JBernardo

What is the main function of a political party?

asked Dec 24, 2023

2 answers 501k views

Calculate the combined mass of the two people if the tension of the cable is 1205.4 N

answered Oct 30, 2023

2 answers 299k views

A compound has the empirical formula ch2o. what are the possible options for the molecular formula of this compound? select all that apply.

asked Oct 25, 2023

1 answer 145k views

One sphere has a radius of 3 inches and another sphere has a radius of 6 inches. The volume of the larger sphere is about how many times the volume of the smaller sphere?

asked Sep 28, 2023

1 answer 482k views

How many moles of LINO3 are equivalent to 525 g LINO3? (LINO3 = 68.95 g/mol) [?] mol LINO3

answered Jul 18, 2023

1 answer 282k views

Can you please help me with this question thank you

asked May 27, 2023

1 answer 225k views

Which progressive government reform allowed voters to vote directly on proposed laws? Please help!!!

asked May 10, 2023

2 answers 59.2k views

How many bytes/second is a 16Mbps cable modem connection?

answered Mar 25, 2023

1 answer 68.6k views

Steve walks o.6 miles to school and 0.6 miles home again each day how many feet does Steven walk in 5 days (1 miles = 5,280 feet)

answered Feb 16, 2023

1 answer 1.5k views

How to do the circumference of a semicircle with a radius of 7 1/2.

answered Feb 6, 2023

2 answers 231k views

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?

answered Dec 20, 2022

1 answer 301k views

A student is writing an argumentative essay for the school newspaper about why baseball is more fun to watch than basketball. The student wants to revise their essay to include reasons and evidence that

answered Nov 20, 2022

1 answer 69.0k views

What is the range of the function f(x)=−3^x − 4? (−3,∞) (−4,∞) (−∞,−3) (−∞,−4) If you culd please explain thanks

asked Nov 2, 2022

1 answer 278k views

Crane Co. pays its employees twice a month, on the 7th and the 21st. On June 21, Crane Co. paid employee salaries of $4930. This transaction would decrease net income for the month by $4930. be recorded

answered Aug 19, 2022

1 answer 455k views

Triangle P R Q is shown. The length of side P R is 5 n. The length of side R Q is 32 n. Angles R P Q and P Q R are congruent. What is the length of PR? units

asked Jul 20, 2022

2 answers 496k views

Doctor help please... ....................

answered Jun 24, 2022

1 answer 319k views

Find the missing dimension. Use the scale factor 1: 12. Item Model Actual Wingspan Width: 5.4 ft Width: yd

asked Mar 22, 2022

2 answers 27.6k views

Search QAmmunity.org