Recent activity by Iameli

Recent activity by Iameli

Graph the line passing through (−2,3) whose slope is m=4.

asked Jul 22, 2023

1 answer 127k views

An ovum moves from an ovary into the uterine tube where its migration toward the uterus is aided by the peristaltic contractions of the smooth tissues of the uterine tube's walls. Which statement identifies

answered Jul 10, 2023

1 answer 8.0k views

Consider the following chemical reaction: glucose (C6H12O6) + galactose (C6H12O6) → lactose (C12H22O11) Which of the following is/are true of this reaction? 1) it is anabolic but not endergonic 2) it is

answered Jun 27, 2023

1 answer 164k views

Put the events in the correct order. (1. Decomposers increase oxygen consumption) (2. Algae consume the available nutrients and then begin to die off) (3. Decomposers break down algae and increase in number)

answered Jun 23, 2023

1 answer 71.7k views

a 10.2 of the pupils in a school are boys. If there are 96 girls in the school, how many pupils are there in the school?

answered Apr 19, 2023

1 answer 37.1k views

PLS HELP!!! Radical functions

asked Mar 7, 2023

1 answer 115k views

Which of the following is NOT a major type of market? a.Consumer b.Business-to-business c.Educational d.to maximize compliance cost

asked Mar 6, 2023

2 answers 120k views

What is the perimeter of a triangle with vertices at (2, 3) (4, -1) and (-1, -5)?

answered Feb 13, 2023

1 answer 150k views

Which of the following statements explains the importance of fungi to producers? They are the primary source of carbon dioxide in Earth's atmosphere which producers use to store energy They synthesize

asked Jan 17, 2023

1 answer 189k views

The pattern 96, 92, 88, 84, ________ follows the "subtract 4" rule. Study the pattern to find traits that are not obvious in the rule. Explain. pleas in one or 2 sentences

answered Dec 26, 2022

1 answer 10.5k views

Use appropriate units and significant figures. USE THE LAW OF COSINES AND LAW OF SINES. You are flying 75.0 mi/hr on a plane heading north with a wind blowing 15.0 mi/hr 46.0° East of North. What is the

answered Dec 17, 2022

1 answer 81.9k views

In the sentence, "Michael wandered like a lost puppy" the word lost is a past participle. True False

answered Nov 21, 2022

2 answers 146k views

Find the equations of the line. Y=____x + ____

answered Nov 17, 2022

2 answers 67.9k views

Solve using the quadratic formula or factoring ... 5=6x^2 + 13x

answered Nov 7, 2022

2 answers 81.3k views

All i need to know is what x and y is, so could someone help me pls n thx!!

answered Oct 22, 2022

1 answer 117k views

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

answered Oct 18, 2022

1 answer 173k views

1 2 Define the underlined word as it used in the sentence. I am trying very hard to tap into my inner genius during this project

asked Oct 12, 2022

2 answers 46.8k views

Concept 9.7: Write the equation of the circle with center at (-7, 11) and radius of 8.

answered Oct 4, 2022

1 answer 205k views

What is -310.5 as a fraction

answered Jun 26, 2022

2 answers 22.4k views

More maths pl,s answer

answered Jun 20, 2022

2 answers 78.8k views

Search QAmmunity.org