Recent activity by IOrlandoni

Recent activity by IOrlandoni

The quotient of twice a number, d, and 5 more than a number m In algebraic expression?

answered Dec 25, 2023

1 answer 152k views

2 3/7 +=3 what is the second number.

answered Oct 21, 2023

1 answer 103k views

Which of the following would provide the first codon?mRNA: UUCAAUGCCUCAAGGUUAAAGCGGCGGUUCCCUGGCAUG

asked Sep 23, 2023

1 answer 79.7k views

Mark all the relative maximum points in the graph. Just need to be sure I’m correct.

asked Jun 17, 2023

1 answer 98.2k views

For what value of K is (x + k) ² = x² + 22x + k²?¿Para qué valor de K es (x + k) ² = x² + 22x + k²?

answered Mar 11, 2023

1 answer 152k views

Select the correct answer from the drop-down menu. Which statement provides the best introduction to the passage? Marine Biology. A World Within Our World This field studies unique underwater ecosystems

answered Mar 3, 2023

2 answers 117k views

English is not a native language (Make is Affirmative )

answered Mar 1, 2023

1 answer 41.6k views

How to solve this?please

answered Jan 14, 2023

1 answer 163k views

What are two ways translation is regulated?

asked Jan 2, 2023

1 answer 226k views

Two of the angles in a triangle measure 51° and 25°. What must be the measure of the third angle?

answered Dec 23, 2022

1 answer 133k views

The following excerpt is from the Fifth Amendment of the U.S. Constitution. "No person shall be ... deprived of life, liberty, or property, without due process of law; nor shall private property be taken

answered Dec 11, 2022

1 answer 66.2k views

1 2 3 4 5 6 7 8 9 10 TIME REMAINING 55:47 A bill can be either __________, meaning that its contents and the discussion surrounding it are open to anyone, or __________, meaning that most discussions about

answered Dec 6, 2022

1 answer 26.1k views

Mr. Santos signs up for a plan in which he is offered a discounted rate for cable service for four months. After this period, the cost will be an additional $5 per month. His total cost for cable service

asked Dec 1, 2022

1 answer 16.1k views

What is one important way that stelae were used? A) for trade with other groups of people B) as weapons in wars C) to record information about the growing seasons D) all of the above

answered Nov 1, 2022

1 answer 92.8k views

The Parthenon was ________. A a large statue of Apollo in Sparta B a famous temple dedicated to Athena C a school founded by Plato in Athens D the hill on which each city-state was built

asked Oct 20, 2022

1 answer 3.6k views

Can someone help me? I’ll reward points + brainalist

answered Sep 27, 2022

1 answer 186k views

Answer the following question in an English paragraph of three to four sentences, and give at least one example. Why does French art from the 15th century look different than French art from the 19th century?

asked Aug 2, 2022

1 answer 82.3k views

A Federal government is one in which All power is concentrated in the central (national) government O A central organ with limited powers governs alliances Powers are divided between central and local

answered Jun 30, 2022

1 answer 189k views

Fathers and Angels Wes stared back at me after I'd asked my question, letting a moment pass and a smirk flicker across his face before responding. -1 really haven't thought too deeply about his impact

answered Jun 20, 2022

1 answer 188k views

WILL GIVE 30 POINTS NEED HELP PLZZZ

asked May 23, 2022

1 answer 104k views

Search QAmmunity.org