Recent activity by Hy

Recent activity by Hy

How does the dissociable Srb10/11 (Cdk8/CyclinC) module of Mediator repress (or inhibit initiation) transcription? - Cdk8 phosphorylates Cyclin H of TFIIH (in the CAK). This prevents Cdk7 from phosphorylating

answered Oct 10, 2024

1 answer 38.8k views

Why is Ann Putnam bitter towards Rebecca Nurse? A. Rebecca Nurse accused Ann of witchcraft. B. Ann believes Rebecca caused her baby's death. C. Rebecca is having an affair with Ann's husband. D. Rebecca

asked Jun 25, 2024

1 answer 83.9k views

Describe the gender demographics currently in the united states. Make sure to provide examples and statistics to your answer.

asked Jun 15, 2024

1 answer 87.1k views

What is the expanded form of the polynomial (x + y)² + (x² + 2xy + y²)? A) x² + 2xy + y² B) x² + 3xy + 2y² C) x² + 4xy + 2y² D) x^2 + 2x^2 + y^2

asked Apr 7, 2024

1 answer 16.9k views

Hazing is only wrong if it is a physical act; mental abuse is not considered hazing. a) True, as mental challenges are acceptable b) True, if mental abuse is not severe c) False, as any form of hazing

answered Mar 29, 2024

1 answer 20.0k views

Insults from Cecily to Gwendolen

asked Mar 15, 2024

2 answers 217k views

predict the multiplicity for the indicated hydrogen atom or group of hydrogen atoms. note: hydrogen atoms are implied in skeletal structures (or line bond).

answered Mar 10, 2024

1 answer 114k views

Why do you think steiner wrote the main title music last for king kong?

asked Feb 9, 2024

1 answer 126k views

What is the importance of internet in education

answered Sep 17, 2023

2 answers 231k views

Explain why it takes much more effort to stop a freight train compared with a car. Include the terms force, mass and acceleration in your description

answered Sep 15, 2023

2 answers 20.3k views

The ratio at which x axis divides the point (2, - 8) and (-3, 6). Pls tell me the answer as fast as possible... We are having math surprise test today...

asked Jul 23, 2023

1 answer 54.8k views

At a carnival, you ride the "Tilt a Whirl" that achieves an angular speed of 0.76 radians per second. If the ride has a radius of 5 meters, what linear speed in meters per second of a person standing on

asked Jun 25, 2023

1 answer 41.6k views

One more quite normal question but with attachments let us ser please

asked Jun 9, 2023

1 answer 19.3k views

Who is talking in: "I will assume thy part in some disguise and tell fair Hero I am Claudio, and in her bosom I'll unclasp my heart."

answered May 18, 2023

2 answers 36.3k views

What is the solution to the following equation? -6(3x + 2) = -84+2(-6-2x) O 0-6 O 9 -9

answered May 2, 2023

2 answers 14.5k views

4.) Based on the following data, what is the standard Gibbs free energy of formation of the chloride ion at 298 K? (R = 8.314 J/(K · mol)) PbCl2(s) → Pb2+(aq) + 2Cl–(aq); Ksp = 1.7 × 10–5 ∆G°f (kJ/mol)

answered Apr 15, 2023

1 answer 154k views

Can you please give me some more information about this

asked Feb 5, 2023

1 answer 168k views

Write the code for RNA from this DNA STRAND : AAAAAATTTTTTCCCGGGGTTTATATATC

asked Dec 15, 2022

1 answer 196k views

Please help there’s no example on how to do this so I’m confused

answered Nov 23, 2022

1 answer 79.7k views

Which of the following is not a factor in promoting health and wellness in an individual behavior modification being without symptoms wise lifestyle choices being without symptoms - awareness of any predisposition

asked Nov 3, 2022

1 answer 168k views

Search QAmmunity.org