Recent activity by Hy

Recent activity by Hy

What is the importance of internet in education

answered Sep 17, 2023

2 answers 231k views

Explain why it takes much more effort to stop a freight train compared with a car. Include the terms force, mass and acceleration in your description

answered Sep 15, 2023

2 answers 20.3k views

The ratio at which x axis divides the point (2, - 8) and (-3, 6). Pls tell me the answer as fast as possible... We are having math surprise test today...

asked Jul 23, 2023

1 answer 54.8k views

At a carnival, you ride the "Tilt a Whirl" that achieves an angular speed of 0.76 radians per second. If the ride has a radius of 5 meters, what linear speed in meters per second of a person standing on

asked Jun 25, 2023

1 answer 41.6k views

One more quite normal question but with attachments let us ser please

asked Jun 9, 2023

1 answer 19.3k views

Who is talking in: "I will assume thy part in some disguise and tell fair Hero I am Claudio, and in her bosom I'll unclasp my heart."

answered May 18, 2023

2 answers 36.3k views

What is the solution to the following equation? -6(3x + 2) = -84+2(-6-2x) O 0-6 O 9 -9

answered May 2, 2023

2 answers 14.5k views

4.) Based on the following data, what is the standard Gibbs free energy of formation of the chloride ion at 298 K? (R = 8.314 J/(K · mol)) PbCl2(s) → Pb2+(aq) + 2Cl–(aq); Ksp = 1.7 × 10–5 ∆G°f (kJ/mol)

answered Apr 15, 2023

1 answer 154k views

Can you please give me some more information about this

asked Feb 5, 2023

1 answer 168k views

Write the code for RNA from this DNA STRAND : AAAAAATTTTTTCCCGGGGTTTATATATC

asked Dec 15, 2022

1 answer 196k views

Please help there’s no example on how to do this so I’m confused

answered Nov 23, 2022

1 answer 79.7k views

Which of the following is not a factor in promoting health and wellness in an individual behavior modification being without symptoms wise lifestyle choices being without symptoms - awareness of any predisposition

asked Nov 3, 2022

1 answer 168k views

Please i need help with this !!

answered Sep 15, 2022

1 answer 170k views

2.) Write the standard number 0.00007396 in scientific notation. A 7.396 x 10-3 B 7.396 x 10-7 C 7.396 x 10-4 D7.396 x 10-5

answered Sep 11, 2022

2 answers 226k views

PLEASE HELP ME! A skydiver parachutes to the ground. The height y (in feet) of the skydiver after x seconds is y = -10x + 3000. a. Graph the linear equation. b. Interpret the slope, and the x-intercept.

answered Sep 9, 2022

2 answers 213k views

The lengths of two sides of the right triangle ABC shown in the illustration given a= 7cm and b= 24cm

answered Aug 11, 2022

2 answers 179k views

It is an advantage for two species to share the same niche.

asked Jul 28, 2022

1 answer 199k views

Please check my answers!

asked Jul 20, 2022

1 answer 102k views

Choose the best Spanish word to complete the sentence. La clase______tarde todos los dias. comence comenza comienza comenzo

asked Jun 21, 2022

1 answer 6.8k views

PLEASE HELP ITS DUE TODAY (THE LINES ARENT STRAIGHT BUT JUST PRETEND THEY ARE)

answered May 19, 2022

1 answer 117k views

Search QAmmunity.org