Recent activity by Hiraku

Recent activity by Hiraku

Write down the pair of integers whose difference is -6

answered Nov 13, 2023

1 answer 130k views

El lugar en el cine donde compras los boletos es la boletería, o la

answered Oct 26, 2023

1 answer 121k views

Which of the following would provide the first codon?mRNA: UUCAAUGCCUCAAGGUUAAAGCGGCGGUUCCCUGGCAUG

answered Sep 28, 2023

1 answer 79.7k views

What equation represents the line shown:

asked Jul 8, 2023

1 answer 96.6k views

"I know college is stressful, but I am confident you will succeed" is an example of... a phrase a single independent clause a dependent clause two independent clauses

asked Jun 26, 2023

2 answers 180k views

Is the angles 40,30,110 acute obtuse or right

answered May 12, 2023

2 answers 70.8k views

Upon taking power in france in 1830 king charles X did what

asked Apr 23, 2023

1 answer 129k views

Net Post Test: Perimeter, Area, Surface Area, and Volume Submit Tes 7 2 A pyramid has a square base with side s. The height of the pyramid is that of its side. What is the expression for the volum 3 OA

answered Apr 6, 2023

1 answer 192k views

Which statement best discribs hiw muscles respond to weight training

asked Mar 23, 2023

1 answer 200k views

The ratio of boys to girls in a local choir is 7:10. If there are 35 boys in the choir, how many girls are there?

answered Dec 30, 2022

1 answer 212k views

!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!9

asked Dec 24, 2022

1 answer 213k views

Determine the value of the information in scientific notation. The moon is approximately 3.63 × 108 meters from Earth. What is 3.63 × 108 in standard notation?

asked Nov 8, 2022

2 answers 232k views

What factor decreased the Romans’ need to trade food? the growth of industry the construction of roads the creation of aqueducts the improvement of transportation need answer asap

answered Oct 13, 2022

2 answers 148k views

What is the y-intercept of 4(0.6)^x

asked Oct 6, 2022

1 answer 193k views

La calculadora no _____________ encima de mi pupitre. * estoy

answered Oct 6, 2022

2 answers 207k views

Explain the process of obtaining Crystals of sugar from hot super saturated sugar solution

answered Aug 19, 2022

2 answers 77.5k views

2) Give at least five examples of Physical Quantities and give one more unit for each of them.

answered May 2, 2022

1 answer 213k views

SOMEONE HELP ME PLEASE!!!!

answered Apr 27, 2022

2 answers 79.4k views

frieda has 12 red apples and 15 green apples. she is going to share the apples equally among 8 people and keep any extra apples for her self. how many apples will frieda keep for herself

answered Apr 18, 2022

2 answers 193k views

Trinh is catering a wedding that 112 people will attend. She is making two cakes, a chocolate cake and a carrot cake. 0.625 of the guests will be served chocolate cake and the rest will receive carrot

answered Apr 10, 2022

2 answers 140k views

Search QAmmunity.org