Recent activity by Hanz

Recent activity by Hanz

Alexandra invested 40% of his money in mutual funds, 40% in real estate, and 20% in stocks. If the value of the money that he invested in mutual funds, real estate, and stocks grew by 2%, 7%, and 11% respectively,

asked Apr 10, 2024

1 answer 11.3k views

What is the missing Angle

answered Dec 18, 2023

2 answers 171k views

All you need is in the photo which of the following mapping diagram represents the relation?

answered Dec 13, 2023

1 answer 229k views

What is the slope of the line that goes through (-5,-5) and (5,-7)

asked Sep 20, 2023

1 answer 129k views

How did the Texas areospace industry affect the national and world market for consumer products? Answers are in K12 test, so only K12 kids can answer!

asked Sep 17, 2023

1 answer 120k views

Hello un I need help with my Science if you can help me with it

asked Aug 3, 2023

1 answer 27.4k views

Jenna, a 40-year-old female, bought a $650,900, 20-year life insurance policythrough her employer. Jenna is paid weekly. How much is deducted from each of herpaychecks? (use the table) Round answer to

answered Jul 26, 2023

1 answer 196k views

What is 2X to the power of 3 divided by -8X to the power of 4?

answered Jun 23, 2023

1 answer 197k views

Which network protocol is used to handle delivery of information

answered Jun 22, 2023

1 answer 71.8k views

5 minus 16 tenths ……

answered Feb 11, 2023

1 answer 66.5k views

URGENT!! - Read the following times and re-write them using the "and" construction 1. Es la una menos veinte de la tarde 2. Son las dos menos once de la tarde 3. Son las doce menos trece de la noche 4.

asked Jan 8, 2023

1 answer 11.5k views

The basic unit of electric current is the: ohm. ampere. * conductivity. volt. Answer is ampere

answered Dec 16, 2022

2 answers 164k views

30 points!! Choose a work of Indian art created before 1900 and one created after 1900 and compare the two in an essay of approximately 300 words.

answered Dec 13, 2022

2 answers 208k views

13. What is the ground state?

asked Nov 28, 2022

1 answer 129k views

Estimate the unit rate to the nearest hundredth $2.35 12 Grade AA eggs.

asked Nov 19, 2022

1 answer 51.0k views

Anyone know some editorial cartoons made in 2020?

asked Nov 7, 2022

1 answer 70.8k views

Divide .05 by 4 and round to the nearest tenth

asked Oct 23, 2022

1 answer 78.0k views

Transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC

asked Jul 10, 2022

2 answers 24.9k views

What is the constant of proportionality in the proportional relationship y= 4/5x ?

answered Jun 19, 2022

2 answers 83.1k views

What were the arguments for "precision" and "area" bombing in World War II?

asked Jun 7, 2022

1 answer 86.2k views

Search QAmmunity.org