Recent activity by HJED

Recent activity by HJED

Which of the following is an example of negative reinforcement? a.Marty knocks over his mother's prize aspidistra so she sends him to his room for the rest of the day. b.Peter comes in late from his lunch

asked Dec 12, 2024

1 answer 62.4k views

Nifedipine is what type of CCB? What does it do? Best for what kind of patient? a) Nifedipine is a dihydropyridine CCB; It primarily dilates arterioles, reducing afterload; It is best for hypertensive

asked Nov 26, 2024

1 answer 218k views

Choose the number of lone pairs or atoms to complete each description below. A molecule that has a trigonal-planar shape has ___ lone pair(s). A molecule that has a bent shape and a trigonal-planar electron

asked Oct 19, 2024

1 answer 235k views

Can someone help me please A bank loaned out $25,000, part of it at the rate of 3% annual interest, and the rest at 9% annual interest. The total interest earned for both loans was $1,770.00. How much

asked Oct 8, 2024

1 answer 169k views

Why is acceptance an important part of building a healthy lifestyle? O A. Exercise will probably not change much in your life. OB. Healthy lifestyles often create a lot of disappointment. O C. If you understand

answered Sep 26, 2024

1 answer 37.1k views

The back emf constant and the armature resistance of a PMDC motor are 40mVs/rad and 10Ω, respectively. The motor is powered by a 12 V DC source to drive a load, and produces 30mNm electromagnetic torque.

answered Sep 20, 2024

1 answer 100k views

Can you answer this riddle?

answered Jul 3, 2024

1 answer 174k views

What is the tRNA sequence for AGAGAUUCAGCUAGCACGAUA

asked Jul 1, 2024

1 answer 61.8k views

Consider the following energy levels of a hypothetical atom: E4___₋1.0 x 10⁻19J E3___₋5.0 x 10⁻19J E2___₋10 x 10⁻19J E1___₋15 x 10⁻19J (a) What is the wavelength of a photon needed to excite an electron

asked Jun 20, 2024

1 answer 75.9k views

What are the causes of increased ETCO₂?

asked May 12, 2024

1 answer 234k views

1. Your school wants to collect at least 5,000 box tops for a fundraiser. Write and graph an inequality to describe the amount of box tops that your school hopes to collect. Inequality: [Please insert

asked Apr 28, 2024

1 answer 119k views

What is the electrical charge of a neutron?

answered Apr 16, 2024

2 answers 131k views

True or False: In the vertex form of an absolute value function, if "a" is negative, the graph opens up.

asked Apr 5, 2024

1 answer 228k views

The key factor in determining inpatient status is: a. An admitting order by the attending physician b. The number of days the patients stays in the hospital c. The acuity or of the patient's illness d.

asked Apr 4, 2024

1 answer 74.0k views

How did the Hopewell tradition people transform the environment to suit their needs? a. Terraforming b. Agriculture c. Terracing d. Aquaculture

answered Mar 12, 2024

1 answer 132k views

_helps us to draw straight lines according to computer?

asked Jan 10, 2024

1 answer 86.9k views

What’s the approximate value of tan 1

asked Nov 6, 2023

1 answer 230k views

The difference between two numbers is 10 and their sum is 24. Find the numbers.

answered Oct 27, 2023

1 answer 19.8k views

After reading What You Need to Know, write a synopsis (summary) using your own words and phrases to describe the most important information. (20 POINTS)

asked Jul 16, 2023

2 answers 46.2k views

1/4×3/2×8/9 whats the answer?

asked Jul 12, 2023

1 answer 74.8k views

Search QAmmunity.org