Recent activity by Gkee

Question

While ideally the board of directors financial audit committee conducts ethics audits, in most firms they are conducted by A. managers or ethics officers. B. top executives or directors. C. the chief executive

asked Nov 20, 2024

1 answer 170k views

What would be the sequence of an RNA produced by using the DNA sequence shown below as a template? 3′ TACCGTGCGTGACATTAAGCC 5′". Write the sequence from 5′ to 3′, left to right

asked Oct 28, 2024

1 answer 198k views

What is the slope of the line of 5y-7x+3=0?

answered Oct 14, 2024

1 answer 192k views

If an incandescent light bulb used for lighting has an efficiency rating of 5 percent, then for every 1.00 joule of electrical energy consumed by the bulb, how much heat/light energy is produced? A) 0.

asked Oct 13, 2024

1 answer 129k views

Lolanda purchased a Treasury bond with a coupon rate of 2.35% and face value of $100. The maturity date of the bond is 15 April 2029 . (a) Luciana plans to purchase lolanda's Treasury bond on 11 April

answered Aug 26, 2024

1 answer 70.4k views

Intuitionistic logic is a form of logic that doesn't have the law of the excluded middle, or LEM. The LEM says basically that a proposition that is not true is false, and a proposition that is not false

asked Aug 23, 2024

1 answer 151k views

The prices of apples in two different shops are shown below. What is the cost of 24 apples at the cheaper shop? Give your answer in pounds (£). Corner shop Apples £0.40 each. Buy 2 apples, get another

answered Aug 23, 2024

2 answers 50.6k views

Eliza is a chef at a restaurant. She is making spaghetti sauce and put 14 tomatoes and 4 onions in the pot. What is the ratio of tomatoes to onions in the pot? 1) 2:7 2) 7:2 3) 1:4 4) 4:1

asked Aug 22, 2024

1 answer 164k views

Can anyone help me with this question? List and explain the examples of an information systems?

asked Aug 18, 2024

1 answer 224k views

A seller lists property for sale with a broker. In the listing contract, which is legal in Oklahoma, it is stipulated the seller will receive $162,000 'net', will all proceeds above that going to the broker.

answered Jul 31, 2024

1 answer 203k views

Solve the system by substitution. y, equals, minus, x, minus, 32 y= −x−32 y, equals, 7, x y= 7x

answered Jul 14, 2024

1 answer 177k views

Marine sediment with more than 30% biogenous material is called __________. A. oolite B. slime C. clathrate D. mud E. ooze

asked Jun 16, 2024

2 answers 127k views

If an IV catheter is being placed in the jugular vein, the vessel should be occluded at the: A. knee, or just above it B. thoracic inlet C. patient's elbows D. base of the throat

asked May 15, 2024

1 answer 120k views

Question 6(Multiple Choice Worth 5 points) [06.01 LC] How did farmers in New England respond to the Industrial Revolution? Most farmers began to specialize in single crops in response to greater manufacturing

answered Apr 17, 2024

1 answer 101k views

Describe what President Clinton means when he says there is a ""line"" that divides the world (Paragraphs 27-28). Cite evidence from the text.

answered Feb 9, 2024

1 answer 131k views

The mucosa lining the trachea is made of what type of tissue? 1) Epithelial tissue 2) Connective tissue 3) Muscle tissue 4) Nervous tissue

answered Jan 7, 2024

1 answer 157k views

4. How did Hannibal keep control of his vast army?

asked Dec 15, 2023

1 answer 117k views

Which best explains why the Netherlands were looting Spanish ships? plz asap

asked Sep 10, 2023

1 answer 152k views

According to the US Constitution, which branch of the government is responsible for intellectual property law? a Department of Defense b Supreme Court c Congress d Executive Branch

answered Jul 29, 2023

2 answers 139k views

A cone has volume 3 pi, If the cone's radius in r, then what is the height?

asked Jul 14, 2023

1 answer 140k views

Ask a Question