Recent activity by Gkee

Recent activity by Gkee

What would be the sequence of an RNA produced by using the DNA sequence shown below as a template? 3′ TACCGTGCGTGACATTAAGCC 5′". Write the sequence from 5′ to 3′, left to right

asked Oct 28, 2024

1 answer 198k views

Lolanda purchased a Treasury bond with a coupon rate of 2.35% and face value of $100. The maturity date of the bond is 15 April 2029 . (a) Luciana plans to purchase lolanda's Treasury bond on 11 April

answered Aug 26, 2024

1 answer 70.4k views

Intuitionistic logic is a form of logic that doesn't have the law of the excluded middle, or LEM. The LEM says basically that a proposition that is not true is false, and a proposition that is not false

asked Aug 23, 2024

1 answer 151k views

Eliza is a chef at a restaurant. She is making spaghetti sauce and put 14 tomatoes and 4 onions in the pot. What is the ratio of tomatoes to onions in the pot? 1) 2:7 2) 7:2 3) 1:4 4) 4:1

asked Aug 22, 2024

1 answer 164k views

Can anyone help me with this question? List and explain the examples of an information systems?

asked Aug 18, 2024

1 answer 224k views

A seller lists property for sale with a broker. In the listing contract, which is legal in Oklahoma, it is stipulated the seller will receive $162,000 'net', will all proceeds above that going to the broker.

answered Jul 31, 2024

1 answer 203k views

Solve the system by substitution. y, equals, minus, x, minus, 32 y= −x−32 y, equals, 7, x y= 7x

answered Jul 14, 2024

1 answer 177k views

If an IV catheter is being placed in the jugular vein, the vessel should be occluded at the: A. knee, or just above it B. thoracic inlet C. patient's elbows D. base of the throat

asked May 15, 2024

1 answer 120k views

Describe what President Clinton means when he says there is a ""line"" that divides the world (Paragraphs 27-28). Cite evidence from the text.

answered Feb 9, 2024

1 answer 131k views

The mucosa lining the trachea is made of what type of tissue? 1) Epithelial tissue 2) Connective tissue 3) Muscle tissue 4) Nervous tissue

answered Jan 7, 2024

1 answer 157k views

4. How did Hannibal keep control of his vast army?

asked Dec 15, 2023

1 answer 117k views

Which best explains why the Netherlands were looting Spanish ships? plz asap

asked Sep 10, 2023

1 answer 152k views

According to the US Constitution, which branch of the government is responsible for intellectual property law? a Department of Defense b Supreme Court c Congress d Executive Branch

answered Jul 29, 2023

2 answers 139k views

A cone has volume 3 pi, If the cone's radius in r, then what is the height?

asked Jul 14, 2023

1 answer 140k views

The equation and graphs represents two different functions

asked Jun 16, 2023

1 answer 122k views

The diference between two numbers is 3 their sum is 27. What is the smaller number?

answered Jun 14, 2023

2 answers 115k views

What is 48,148 in expanded form?

asked May 17, 2023

1 answer 97.3k views

Factor the gcf 6x^2 - 2x

asked Apr 27, 2023

1 answer 89.1k views

Decide if the following sentence is grammatically CORRECT or INCORRECT. Sie trägt eine neue Sonnenbrille. Correct Incorrect

asked Apr 18, 2023

2 answers 77.2k views

What was most likely caused a change in the soil in the wheat field shown?

answered Aug 22, 2022

1 answer 190k views

Search QAmmunity.org