Recent activity by Gerard Banasig

Recent activity by Gerard Banasig

Explain how society constitutes social structure

answered Dec 21, 2024

2 answers 221k views

Solve the logarithmic equation. When necessary, round answer to the nearest hundredth. log x 36 = 2 a. x = 18 b. x = ±6 c. x = 6

answered Oct 16, 2024

1 answer 69.8k views

Abel Jones failed to yield the right of way to Zelda Painter. The accident caused $1,290 damage to Zelda's car and $3,365 damage to Abel's car. How much should Abel's insurance company pay? a) $0 b) $1,

answered Oct 15, 2024

1 answer 160k views

What are the principles that the conduct of the ARMY PRT follows?

asked Sep 25, 2024

1 answer 85.3k views

Two trains, Train A and Train B, weigh a total of 147 tons. Train A is heavier than Train B. The difference of their weights is 65 tons. What is the weight of each train?

asked Sep 14, 2024

1 answer 217k views

Is characterized by the easterly transitioning of warm water by breezes in the western Pacific Ocean. O Monsoon O La Niña O El Niño O Equinox

answered Aug 11, 2024

1 answer 121k views

What is one of the steps you need to take if you choose to affiliate with more than one Delaware broker?

asked Jul 5, 2024

1 answer 7.3k views

For an 18-month-old weighing 23 pounds, how much ibuprofen would be administered if the usual dose is 5 mg per kilogram of body weight when the fever is under 102.5°F? a) 10 mg b) 20 mg c) 30 mg d) 40

answered May 17, 2024

1 answer 60.3k views

A common reducing agent found in the salon is

answered Mar 4, 2024

1 answer 90.5k views

Which of these inferences about the point article is best supported by the text? a) The author supports a specific political party. b) The article presents a neutral perspective. c) The main argument is

answered Feb 26, 2024

1 answer 200k views

Which of the following statements is True about most Blue Cross Blue Shield organizaitons? a) They primarily offer life insurance products. b) They are for-profit organizations. c) They operate as health

answered Feb 24, 2024

1 answer 160k views

Which of the following statements are true? (Select all that apply.) -Assets are amounts owed to other entities -Liabilities are amounts owed to other entities -Liabilities are claims against the firm

asked Feb 9, 2024

1 answer 162k views

Is a semiannual coupon bond more sensitive than one with annual coupon? 1) Yes 2) No

answered Feb 1, 2024

1 answer 217k views

In the following DNA secuence how many units of information (codons) are?ATCGACGTTGCAGCAGTAGTC

asked Jan 12, 2024

1 answer 169k views

At which do children have the strongest belief in the existence of Santa Clause O Conventional Formal Operational O Concrete Operational O Preoperational O Sensorimotor

answered Dec 10, 2023

1 answer 186k views

Find f(-1) with the graph

asked Nov 22, 2023

2 answers 234k views

Find the volume of the figure. ____cm3

answered Aug 9, 2023

1 answer 106k views

What produces Earth's magnetic field? A) the pressure of Earth's crust upon Earth's mantle B) the rotation of Earth's core C) the movement of Earth's tectonic plates D) the bombardment of Earth's atmosphere

answered Jul 13, 2023

1 answer 123k views

What is the answer? b^2+2b-8=0

asked Jun 18, 2023

1 answer 131k views

I have a calculus question about related rates, pic included

asked Jun 4, 2023

1 answer 73.9k views

Search QAmmunity.org