Recent activity by FlorianTopf

Recent activity by FlorianTopf

Help me solve this asap

answered Dec 24, 2023

1 answer 72.7k views

which of the following stages of Erickson’s stages of development does a child first find themselves judged by others outside their families

answered Dec 22, 2023

1 answer 194k views

Informative Essay about bullying

answered Dec 13, 2023

1 answer 217k views

If I don't get an A in math my mom will hit me again What is the product? Enter your answer as a fraction, in simplified form, in the box. -1/4 x -6/11

answered Oct 14, 2023

1 answer 123k views

The Congress also endorses the Suffolk Resolves What are the 2 main points of the Suffolk Resolves? HELPPPPPPPP

answered Aug 13, 2023

2 answers 4.5k views

Suppose you roll a die 5 times. What is the probability of getting at least one odd number ?

asked May 25, 2023

1 answer 234k views

Debra takes classes at both Westside Community College and Pinewood Community College. At Westside,class fees are $98 per credit hour,and at Pinewood, class fees are $115 per credit hour. Debra is taking

asked Mar 5, 2023

1 answer 16.9k views

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT

answered Feb 1, 2023

1 answer 150k views

What is the input for air cooler computer science

answered Jan 5, 2023

2 answers 15.6k views

Use the perimeter to find the length of segment AD. This is the distance from A to D. Explain how you found your answer.

answered Dec 21, 2022

2 answers 95.3k views

Mr. Bonet has a fair coin labeled “heads” and “tails.” He will flip the coin 6 times and record his results. What is the probability that the coin will land face-up on “tails” on all six flips?

answered Oct 21, 2022

1 answer 109k views

HELP! What is the value of x? (Picture)

answered Oct 7, 2022

2 answers 133k views

Compare the properties of the moon to those of earth

answered Sep 29, 2022

1 answer 218k views

How do you write 21% as a fraction, mixed number, or whole number?

asked Sep 5, 2022

1 answer 104k views

What is moral values?

answered Jun 20, 2022

1 answer 126k views

Evimi Simplify 6(3+4) - 5(1 + 2).

answered Jun 17, 2022

2 answers 201k views

If coefficients aren’t equal or opposite, you can do a little manipulation so that you can still use the elimination

asked Jun 11, 2022

1 answer 185k views

1(s+10)+7<8 nnnnnnnnnnnnnnnnnn

answered Apr 29, 2022

1 answer 8.3k views

Solve: V5x+1+6=4 V=square root

answered Feb 24, 2022

2 answers 166k views

15. Two short haired guinea pigs are mated several times. Out of 100 offspring, 25 of them have long hair. What are the probable genotypes of the parents?

answered Feb 21, 2022

2 answers 121k views

Search QAmmunity.org