Recent activity by Drys

Recent activity by Drys

Are you jealous about Turkey ? They are so strong and their country has a beatifull places

answered Oct 28, 2023

1 answer 234k views

Would x - 4 be -4x or just leave it as x pls answer

asked Sep 27, 2023

1 answer 111k views

Two rocks, A and B, are thrown horizontally from the top of a cliff. Rock A has an initial speed of 10 meters per second and rock B has an initial speed of 20 meters per second. How would you describe

answered Jul 13, 2023

1 answer 188k views

Directions: Respond to one of the prompts below. DO NOT PLAGIARIZE write your own words (500) Write a short story about characters who are on a boat or In your opinion, what is the nature of man? (Are

answered Jul 12, 2023

1 answer 50.2k views

A company sells widgets. The amount of profit, y, made by the company, is related tothe selling price of each widget, x, by the given equation. Using this equation, find outwhat price the widgets should

asked Jul 12, 2023

1 answer 10.5k views

Artificial intelligence (AI) refers to the intelligence of machines. The term also refers to the developing field of computer science that is responsible for creating intelligent machines. Scientists and

asked Jun 23, 2023

1 answer 4.0k views

What is 7[2.5 + 3(12 - 7)] and can you please show me how to do it

asked Apr 17, 2023

1 answer 42.0k views

How do i write out the equation please include states and the balancing with the work

asked Feb 25, 2023

1 answer 162k views

According to Brutus, what motivated his decision-making? Civic pride Broken friendship A sense of good luck Fear of Caesar’s past behaviors

asked Jan 26, 2023

1 answer 90.9k views

DUE IN A FEW MINS!!!!Do only number 25 pls I’m confused!! Also, please explain how u got it !!

asked Jan 12, 2023

1 answer 170k views

PLESE HELP ME RN PLEASE Write an algebraic equation for this tape diagram. Then determine the value of x. You may use a calculator.

answered Dec 9, 2022

1 answer 75.5k views

Type the correct answer in each box. Enter the expressions in the simplest form. A polygon is translated 3 units to the right and 4 units down, then it’s reflected across the x-axis, and then it’s dilated

answered Nov 15, 2022

1 answer 132k views

Which statement best explains how going to work affected women during and after ww1

asked Nov 8, 2022

1 answer 177k views

-2.2y + 0.6 – 0.3y + 1 Help me solve this two step equation pls

answered Oct 15, 2022

2 answers 17.8k views

−7x−8y=9 −4x+9y=−22 HELP FAST !!!!!!!!!

asked Sep 27, 2022

1 answer 203k views

Transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC

answered Jul 17, 2022

2 answers 24.9k views

Jayne stopped to get gas before going on a road trip. The tank already had 4 gallons of gas in it. Which equation relates the total amount of gasoline in the tank, y, to the number of gallons that she

asked Jun 28, 2022

2 answers 121k views

Is 70.24 greater or less then 70.240

answered Jun 28, 2022

2 answers 147k views

Why does the government believe Harrison Bergeron is a criminal

asked May 26, 2022

1 answer 7.4k views

9n - 7 = 5n - 19 What is n and why did you do that

asked May 19, 2022

1 answer 199k views

Search QAmmunity.org