Recent activity by Dirk Paessler

Recent activity by Dirk Paessler

Pls help asap!! due in a hour:( thanks in advance

answered Dec 30, 2023

1 answer 99.1k views

How did the religion affect who was in the upper class?

asked Dec 13, 2023

1 answer 71.4k views

Complete all the sentences. Need help Giving 20 points

asked Dec 4, 2023

2 answers 16.6k views

What is the common difference of the following sequence 16 19 22 25

answered Nov 20, 2023

1 answer 35.5k views

How did the rule of the first Seven Kings of Rome end?

answered Nov 8, 2023

1 answer 96.3k views

Why is “no” one of the dierect object pronouns for Spanish

asked Aug 1, 2023

1 answer 70.6k views

What you learned from painting? 5-6 sentence?!?!?!!!?!?!?!?!?!?

answered Jun 3, 2023

2 answers 172k views

There are 20 students in Mrs. Kahlid's sixth-grade class. Two out of every 8 students play basketball. How many students play basketball?

asked Apr 19, 2023

1 answer 92.3k views

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT

asked Jan 27, 2023

1 answer 150k views

A person dove more than 100 feet below sea level. Which value could represent the elevation, in feet, that the person dove? A. -125 B. -50 C.60 D.150 please help i just have 10 minutes left dont troll

asked Oct 26, 2022

2 answers 167k views

Please urgent please beg

answered Oct 3, 2022

2 answers 216k views

Barrybuysasurfboardonlinefor$66.Ifshippingandhandlingareanadditional10%oftheprice,howmuchshippingandhandlingwillBarrypay?

asked Oct 2, 2022

1 answer 95.8k views

If f(x)=1/x and g(X) = x-2, which of the following is the graph of (f•g)(x)?

answered Sep 10, 2022

1 answer 229k views

What is the relationship like between Guido and his son, Joshua? Explain how you know with specific examples. (in life is beautiful)

asked Aug 18, 2022

1 answer 50.8k views

The estimated standard error of the mean is to be used whenever you must estimate the __________ of the population.

asked Jul 26, 2022

1 answer 29.7k views

Can someone help me please?

answered Jul 23, 2022

2 answers 195k views

Assume the state of Alaska placed a tax on playing cards of 5 cents per pack. If the state generated $55500 in revenue, how many packs of cards were sold?

answered Jul 7, 2022

1 answer 65.9k views

What is the approximate area, in square units, of the circle shown below?

asked Jun 28, 2022

1 answer 132k views

Helpppppppppp plzzzzzzzzzzz

answered Jun 24, 2022

2 answers 220k views

Find the area of the figure below, composed of a rectangle and a semicircle. Round to the nearest tenths place.

answered Jun 20, 2022

1 answer 133k views

Search QAmmunity.org