Recent activity by Dimitar Stefanovski

Recent activity by Dimitar Stefanovski

What actually the value of X because I’m still processing how this goes. Can someone pls help me

answered Sep 28, 2023

1 answer 188k views

The "final solution to the jewish question" was hammered out at the conference.

asked Aug 4, 2023

1 answer 80.8k views

A washer and a dryer cost $572 combined. The washer cost $78 less than the dryer. What is the cost of the dryer?

answered Jul 28, 2023

1 answer 182k views

In the presidential election of 1928 , the republican candidate was

answered Jul 17, 2023

2 answers 154k views

Listen to what Elisa says and answer the question according to what you hear. Where did she and her husband go first during the year? A) New York B) Jerusalem C) A cabin or D) Brazil

asked Jun 25, 2023

2 answers 22.2k views

How did trade help to spread and connect ideas from different cultures? List at least two ideas that may have traveled along the trade routes on the map.

asked Jun 4, 2023

1 answer 218k views

5. Answer the questions based on the graph provided, zero(2,5) (7,8]a. During which interval(s) was the car stopped?Dx-valuesb. During which interval was this personaltraveling at the fastest speed? Explain

answered May 4, 2023

1 answer 234k views

Gillian works from 23 to 33 hours per week during the summer. She earns $12.50 per hour. Her friendEmily also has a job. Her pay for t hours each given is given by the function e(t) = 13t, where 18 st

answered Mar 27, 2023

1 answer 200k views

Hey I’m doing a project but I don’t get it at all but overall we’re doing a project about buying a home the estimate price of my home is overall $290,000 and I was told to pick two loan options for 30

answered Mar 7, 2023

1 answer 221k views

Katsuro ran 3 1/6 miles each day for 7 days. How far did he run in all?

answered Dec 11, 2022

2 answers 126k views

During protein synthesis which molecule can be inside the nucleus and outside in the cytoplasm?

answered Dec 4, 2022

1 answer 40.8k views

Help plz i need help as soon as posible i cand do physics

answered Nov 29, 2022

1 answer 211k views

You have learned about two very important leaders of the Civil Rights Movement, Martin Luther King Jr. and Malcolm X. What do you think are the possible benefits and shortcomings of each leader's approach

asked Nov 16, 2022

1 answer 66.1k views

A circle has an area of 1809.5573. What is the radius? (round to the nearest whole number)

asked Nov 7, 2022

2 answers 193k views

Classmate Date Page cause G Inclustrialization and urbanization environmental imbake imbake. Justify according to class 7

answered Oct 22, 2022

1 answer 93.7k views

How is hydrogen isolated from water

asked Sep 2, 2022

2 answers 66.9k views

Applying: Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTGAGACCTGGCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label

answered Aug 31, 2022

1 answer 3.3k views

Please help and please explain

answered Aug 27, 2022

1 answer 2.9k views

Read the passage Which sentence from the passage is the best evidence that Ben is eager for the next family road trip to begin? Cross-Country "A new cross-country adventure was just around the O corner

answered Aug 23, 2022

1 answer 48.5k views

What is the value of z in the equation 2 (4z − 9 − 11) = 166 − 46? (1 point) A. 15 B. 20 C. 30 D. 35

asked Jul 24, 2022

2 answers 165k views

Search QAmmunity.org