Recent activity by Deepesh Uniyal

Question

On a manufacturer's assembly line, 3% of its merchandise comes off defective. If the company has 354 defective items, how many total items came off the assembly line? a. 11,800 b. 106.2 c. 10.62 d. 1,180

asked Dec 26, 2024

1 answer 136k views

Around the year A.D. 1000, Vikings were the first Europeans to reach: a) North America b) Australia c) South America d) Africa

asked Dec 16, 2024

1 answer 196k views

Predict the products of the double replacement reactions given. Check to see that the equations are balanced. BaCl2 + MgSO₄ → ? 1) BaMgClSO₄ 2) Ba(SO₄)2 + MgCl2 3) BaMgCl2 + BaSO₄ 4) MgCl + BaSO₄

asked Nov 3, 2024

1 answer 93.4k views

Which set of numbers are integers but not whole numbers or natural numbers? A) (-2, –3, –4) B) (√1, 74, 7-5) C) (√2, 7, √3)

answered Oct 30, 2024

2 answers 114k views

Type the correct answer in the box. What could result in a pregnancy? Pregnancy may occur due to failure of control. Reset

asked Aug 22, 2024

1 answer 54.9k views

The solubility of manganese carbonate MnCO₃ is 4.8x10^-4 g/l. what is the solubility oproduct constant for manganese carbonate?

answered Aug 14, 2024

1 answer 200k views

I NEED THIS LIKE RIGHT NOW 1.What does the use of the pronouns they and we in paragraph 2 suggest about the narrator's point of view? How does this point of view reflect the theme of the excerpt?

answered Jul 12, 2024

1 answer 194k views

What is the medical term for anxiety patient feels when encountering medical staff?

answered Jul 9, 2024

1 answer 93.7k views

Identify the true statements about an expatriate's base salary in the context of international management. (Check all that apply.) a. It is the standard against which benefits and bonuses are calculated.

answered May 28, 2024

1 answer 204k views

The abusive sergeant from j company who lectured the men at the seawall?

answered May 26, 2024

1 answer 47.7k views

The reproductive asymmetry between primate males and females can be seen in the fact that __________.

answered May 15, 2024

1 answer 16.1k views

What are some parallels between the racial profiling experienced by Mexican-American youth in the 1940s and current perceptions of underrepresented groups in our society?

answered May 6, 2024

1 answer 228k views

Which statements about writing are correct? 1) The pace of a text is the speed at which events develop. 2) The pace of a text is the feeling, or atmosphere, of a story. 3) Authors use longer sentences

answered Mar 3, 2024

1 answer 54.7k views

7. The mass of an electron is negligible compared to the mass of a proton and neutron why?

answered Feb 16, 2024

1 answer 183k views

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. Original DNA strand 3' → 5' His_H_His_-_His_-_His_~_His_-_His Mutated DNA strand 3' → 5' GTAGTAGTAGGAGTAGTAGTA

asked Feb 11, 2024

1 answer 94.4k views

A large shipment of disposable flashlights contains 1% that are defective. Use the Poisson approximation of the binomial distribution to find the probability that among 200 flashlights randomly selected

asked Feb 7, 2024

1 answer 158k views

Which of these accurately describes the cause of transfer of heat by conduction? A) Transfer of energy by absorption of electromagnetic waves. B) Transfer of energy by collisions of particles in solids.

answered Dec 9, 2023

2 answers 189k views

1.3 1.5 2.2 2.2 2.8 What is the mean median mode range

asked Oct 21, 2023

1 answer 110k views

There are 64 students in the school band. There are 16 trumpet players. What fraction of the band are trumpet players?

asked Oct 4, 2023

1 answer 119k views

Label generation is time consuming task

answered Sep 27, 2023

2 answers 209k views

Ask a Question