Recent activity by Decoy

Recent activity by Decoy

What effect did the peach have on the lives and economies of the new and old world societies

answered Dec 25, 2024

1 answer 151k views

3 kg of mussels cost $42.90. Find the cost of 300 g of mussels.

asked Dec 20, 2024

1 answer 30.7k views

Which workplace situation requires critical thinking? 1) Ordering pizza for everyone at work 2) Designing advertising campaigns 3) Being on the event organizing committee 4) Planning outfits for the upcoming

asked Aug 25, 2024

1 answer 206k views

Define the term "pyramidal sign." A) A neurological symptom associated with the corticospinal tract. B) A visual illusion. C) A type of reflex in the spinal cord. D) A sign of a specific genetic disorder.

asked Aug 15, 2024

1 answer 187k views

A customer opens a checking account and a savings account at a bank. They will deposit a maximum of $600, some in the checking account and some in the savings account.(They might not deposit all of it

answered Aug 2, 2024

1 answer 210k views

The following are common ____________________: a.Winding voltage ratings b.Dual rated transformers c.Tap changers d.Common transformer testing

asked Jul 24, 2024

1 answer 232k views

Which of the following metric prefixes corresponds to 10⁻³? a. Kilo b. Mega c. Milli d. Micro

answered Jul 24, 2024

1 answer 221k views

Which of the following is an inconsistency in dictation that should be flagged for the dictator's review and correction? a) Clarity and accuracy. b) Speed of dictation. c) Dictator's accent. d) Font style.

answered Jul 14, 2024

1 answer 24.2k views

How much should be invested each month at 10% for it to accumulate to $7,000 in 4 years

answered May 28, 2024

1 answer 232k views

May 03, 2023 i) y = -1/2x² + 6x + 5 2

answered Feb 27, 2024

1 answer 144k views

A spinner is divided into 10 equally sized sectors. The sectors are numbered 1 to 10. A randomly selected point is chosen. What is the probability that the randomly selected point lies in a sector that

answered Feb 16, 2024

2 answers 98.7k views

Identify the altele(s) in this stretch of DNA. The top fragment is from the paternal chromosome and the bottom fragment is from the maternal chromosome. GCAATCAGTCAGTCAGTTATCGGG GCAATCAGTCAGTCAGTCAGTCAGTTATCGGG

asked Jan 20, 2024

1 answer 234k views

Mortgage 15-year Monthly payments 9.0%APR Loan amount $100,000 The interest portion of the first payment is closest to a. $950 b $900 c. $750 d. $650 e. $373 f. $823 g. $600

answered Jan 19, 2024

1 answer 32.0k views

Many developmentally find middle schools

asked Jan 15, 2024

1 answer 18.1k views

PLEASE HELP IXLL i need to answer this one right only a couple more points

answered Jan 9, 2024

1 answer 202k views

9168 divided by 24 long division

asked Dec 6, 2023

1 answer 52.3k views

What is the definition of gully ?

asked Dec 3, 2023

2 answers 2.8k views

choose the sentence that complete the fact family like 3×6=18 18÷6=3 6×3=18 is it a 6÷3=2 b 18÷3=6 c 9÷3=3 d 18÷9=2 is it abc or d

answered Oct 25, 2023

1 answer 228k views

What is the theme for Rachel’s Story

answered Sep 20, 2023

2 answers 163k views

I need the answer but i also need to check my answer after

asked Mar 21, 2023

1 answer 201k views

Search QAmmunity.org