Recent activity by Deadboy

Recent activity by Deadboy

Could you help with the answer I’m in a big rush and am stuck on this question

answered Nov 21, 2023

1 answer 33.1k views

Here is a scatter plot that shows the years when some used cars were made and their prices in 2016, together with the graph of a linear model for the relationship between year and price. a is the slope

asked Oct 27, 2023

1 answer 37.5k views

A pound of fertilizer covers 31 square feet of lawn. Vivian Bulgakov's lawn measures 9480.5 square feet. How much fertilizer, to the nearest tenth of a pound, does she need to buy?

answered Sep 27, 2023

2 answers 208k views

For each of the following, classify homogenous mixture, heterogeneous mixture, compound, or element. a. Air _____________ b. Glucose _____________ c. Table Salt (NaCl) _________ d. Sand and Water__________

asked Jun 21, 2023

2 answers 155k views

5 REREAD Reread lines 77-94. How is Huston affected by the jazz performance? What does it reveal about her Text: the Harlem renaissance

asked Apr 24, 2023

1 answer 63.2k views

300.6 divided by 18 long division

asked Apr 8, 2023

1 answer 230k views

What concept does this painting illustrate? a painting showing a large white woman walking over the hills and forests of the countryside with a people driving covered wagon, stagecoaches, and trains. She

answered Mar 29, 2023

2 answers 136k views

Write the equation of a line that has a slope of m = 4/3 going through the point (-1,-2)

asked Mar 6, 2023

1 answer 198k views

What is the value of the expression-1/6(y-27) when y= -3. Enter the answer as an integer or a decimal in the box below.

answered Jan 12, 2023

1 answer 133k views

Using the same, non-mutated sequence of DNA , repeat the process you just completed, but this time, for an insertion mutation. Randomly insert a base. Original DNA gene: GATCGATACCATTCGGCGCATACTTCG A)The

asked Nov 28, 2022

1 answer 146k views

1. Twenty-one is equal to the sum of two x's plus nine and four tenths. What is x?

answered Nov 17, 2022

1 answer 186k views

The nickname “Desert Fox” was used for a German war hero in World War II. He was extremely skilled in warfare involving tanks and surprise attacks. His real name was....

answered Oct 9, 2022

1 answer 190k views

Do you prefer ranch or italian sauce

answered Sep 14, 2022

1 answer 44.9k views

Is the inverse a function? y=x+2 6.

answered Sep 13, 2022

1 answer 169k views

Is square root of 11+10 a rational or irrational number

answered Sep 12, 2022

2 answers 231k views

Jeremiah's barber charges $20 for a haricut. The barber is increasing his prices by 40%. What will Jeremiah have to pay the barber the next time he gets a haircut?

asked Sep 2, 2022

1 answer 215k views

On June 30, 2021, the High Five Surfboard Company had outstanding accounts receivable of $720,000. On July 1, 2021, the company borrowed $570,000 from the Equitable Finance Corporation and signed a promissory

answered Jul 17, 2022

1 answer 104k views

What is the most important obstacle James Forten faceted

asked May 6, 2022

1 answer 115k views

Can Someone help me please. My brain can't comprehend anymore. Anyone familiar with this problem. Angela works 18 hours a week for 12 weeks in the summer at the local swimming pool as a life guard. She

answered May 2, 2022

2 answers 6.2k views

Which doesn't belong

answered Apr 25, 2022

1 answer 115k views

Search QAmmunity.org