Recent activity by Deadboy

Question

What happens to surrounding air when a refrigerant condenses and why does it happen? a) Expands, absorbs heat b) Contracts, releases heat c) Expands, releases heat d) Contracts, absorbs heat

answered Dec 4, 2024

1 answer 67.0k views

Which aspect of Dr. Paul Kalanithi's background influenced his approach to working with patients and illness? A. Extensive medical training B. Strong scientific knowledge C. Master's in English Literature

answered Nov 15, 2024

1 answer 92.7k views

The following changes took place last year in Pavolik Company's balance sheet accounts: Asset and Contra-Asset Accounts Cash Accounts receivable Inventory Prepaid expenses Long-term investments Property,

answered Aug 24, 2024

1 answer 148k views

Chloe asked students in her school band these two questions: Question 1: How many days per week do you practice your instrument? Question 2: How many times will our band perform this year? Which Question

answered May 31, 2024

1 answer 56.4k views

if 20 men can complete a piece of work in 16 days how many men should be exiled to finish the work in 20 days?

answered Apr 25, 2024

1 answer 36.4k views

A magazine pays authors by the word for essays that are submitted. Authors are paid $0.10 per word for the first 250 words and $0.05 per word for every word after 250 words. Sam submitted three essays:

answered Apr 6, 2024

1 answer 185k views

Sociology can most accurately be considered a natural science because it involves the systematic examination of the effects of human nature on society. A True B False

answered Mar 27, 2024

1 answer 21.2k views

Which product is a genetically modified organism (GMO)?

answered Feb 23, 2024

1 answer 4.1k views

25 is 29% of what number

answered Feb 20, 2024

1 answer 33.4k views

Does salt increase the temperature of NaOH

asked Jan 26, 2024

1 answer 106k views

Could you help with the answer I’m in a big rush and am stuck on this question

answered Nov 21, 2023

1 answer 33.1k views

Here is a scatter plot that shows the years when some used cars were made and their prices in 2016, together with the graph of a linear model for the relationship between year and price. a is the slope

asked Oct 27, 2023

1 answer 37.5k views

A pound of fertilizer covers 31 square feet of lawn. Vivian Bulgakov's lawn measures 9480.5 square feet. How much fertilizer, to the nearest tenth of a pound, does she need to buy?

answered Sep 27, 2023

2 answers 208k views

For each of the following, classify homogenous mixture, heterogeneous mixture, compound, or element. a. Air _____________ b. Glucose _____________ c. Table Salt (NaCl) _________ d. Sand and Water__________

asked Jun 21, 2023

2 answers 155k views

5 REREAD Reread lines 77-94. How is Huston affected by the jazz performance? What does it reveal about her Text: the Harlem renaissance

asked Apr 24, 2023

1 answer 63.2k views

300.6 divided by 18 long division

asked Apr 8, 2023

1 answer 230k views

What concept does this painting illustrate? a painting showing a large white woman walking over the hills and forests of the countryside with a people driving covered wagon, stagecoaches, and trains. She

answered Mar 29, 2023

2 answers 136k views

Write the equation of a line that has a slope of m = 4/3 going through the point (-1,-2)

asked Mar 6, 2023

1 answer 198k views

What is the value of the expression-1/6(y-27) when y= -3. Enter the answer as an integer or a decimal in the box below.

answered Jan 12, 2023

1 answer 133k views

Using the same, non-mutated sequence of DNA , repeat the process you just completed, but this time, for an insertion mutation. Randomly insert a base. Original DNA gene: GATCGATACCATTCGGCGCATACTTCG A)The

asked Nov 28, 2022

1 answer 146k views

Ask a Question