Recent activity by Davejohnson

Recent activity by Davejohnson

How do you divide by 10,100,1000

answered Jan 3

1 answer 125k views

If a = 12 feet, b = 6 feet, c = 2 feet, d = 15 feet, and e = 3 feet, what is the area of the object?

answered Nov 20, 2023

1 answer 278k views

What is the smallest thing on earth?

answered Sep 1, 2023

1 answer 141k views

What is the volume of a rectangular prism that is 8 m long, 7 m wide, and 5 m tall? Include your steps, answer and label. (15 points)

answered Jul 21, 2023

1 answer 483k views

Please helpp i have a test tmr

answered Jul 11, 2023

1 answer 356k views

Given Point A, what is the coordinate for A' after the following transformation has occurred?(x, y) + (2 - 5, -y + 2)A (5,7)Al

answered May 15, 2023

1 answer 538 views

Which of the following was not a historical event that was directly tied to a commonly held stereotype? African slavery segregation in the United States the Holocaust the cold war

asked Apr 21, 2023

1 answer 360k views

Calculate the average atomic mass of Mg if the naturally occurring isotopes are Mg - 24, Mg - 25 and Mg - 26. Their masses and abundances are as follows: Mg - 24 relative atomic mass = 23.985 amu % abundance

asked Mar 9, 2023

1 answer 289k views

What is the answer to this?

asked Nov 12, 2022

1 answer 518k views

Ashely burns 0.48 calories for every 20 feet she runs.How many calories would she burn after running 2 miles?

answered Sep 20, 2022

1 answer 56.0k views

Please help. I struggle on these so bad.

answered Aug 23, 2022

1 answer 227k views

18 The length of a rectangle is twice as long as the width of the rectangle. The area of the rectangle is 32 cm. Draw the rectangle on the centimetre grid. . 4 54 B2 % I did it wrong can someone help me

asked Jun 28, 2022

1 answer 448k views

What is the complementary DNA of TACCGGATGCCAGATCAAATC?

answered Apr 22, 2022

1 answer 31.7k views

Which of the following statements concerning moral development is not true? Please select the best answer from the choices provided O Children generally become better at telling the difference between

answered Mar 3, 2022

2 answers 511k views

The sardines gave the sea ‘a molten metal appearance. Why?

asked Feb 17, 2022

1 answer 37.5k views

Search QAmmunity.org