Recent activity by Carioni

Recent activity by Carioni

The area of a triangle is 7.5 . The base of the triangle is 5 cm .what is the height of this triangle.

answered Nov 19, 2023

2 answers 221k views

Simplify 8(x + 3)^2/2(× + 3)

asked Jun 15, 2023

1 answer 199k views

Find the volume of a cube with a side of 6 cm. It has a mass of 457 g. Find its density and label with correct units.

asked May 24, 2023

2 answers 205k views

Sphagnum moss grows in a type of wetland called a(n

answered May 24, 2023

1 answer 52.1k views

Why is a focal point important in landscapes? What types of things can be used as focal points?

answered May 14, 2023

2 answers 109k views

i need help with mathematics a triangle has angles measurements of 151 , 28 , and 1 . what kind of triangle is it?

answered Mar 5, 2023

1 answer 175k views

Question 2Select all tables that represent a proportional relationship.Number of PeachesCost (dollars)33.7578.751113.75Number of HoursCost (dollars)210041506200Number of HoursEarnings (dollars)65487211114Number

answered Feb 11, 2023

1 answer 14.7k views

What is the positive value for this number? How far from 0 is the number on a number line? and don't delete it

answered Jan 17, 2023

2 answers 49.2k views

Which of the following is considered a citizen’s most important right and civic responsibility? A. voting B. being informed C. respecting others D. military service Please select the best answer from the

asked Dec 18, 2022

1 answer 86.4k views

Which statement about the angles in the figure is true? Helppp

answered Dec 18, 2022

1 answer 72.8k views

Necesito una historia que tenga los verbos : manejó - comió - voló - olvidó - obtuve - di - fui - tenía - sabía - se fue

answered Nov 14, 2022

1 answer 77.9k views

PLEASE HELP ASAP!!! What is biodiversity? the rapid disappearance of a species in an area the total number of different species in an area the rapid appearance of a species in an area the total number

asked Sep 14, 2022

2 answers 115k views

5. Calculate the following in Z.. (a) 2 +3 (b) 2+2+2 (c)-3

asked Aug 27, 2022

1 answer 207k views

10. ¿______ tú nervioso hoy?

answered Aug 18, 2022

2 answers 195k views

What is the solution to this equation? -16x= 80 O A. x= -96 O B. x= 96 O C. x = 5 O D. x= -5

answered Aug 13, 2022

2 answers 223k views

Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT HELP ME PLEASEEEEE !!

answered Aug 1, 2022

1 answer 20.7k views

URGENT PLEASE HELP !!!

asked Jun 23, 2022

2 answers 84.6k views

This question is for brilliant student . how to increase oxygen or how oxygen increased in earth because in many years ago at past earth has only have 2% of oxygen but know it has 22% of oxygen

asked May 28, 2022

1 answer 200k views

You randomly choose one of the tiles. Without replacing the first tile, you randomly choose a second tile. Find the probability of the compound event. Write your answer as a fraction or percent rounded

answered May 18, 2022

2 answers 156k views

Fred is a 20-year-old who lives in a large metropolitan city. He graduated high school but decided that he would get a job immediately following high school instead of going to college. He thought making

answered May 14, 2022

1 answer 59.8k views

Search QAmmunity.org