Recent activity by Caniko

Question

In ballet, it is a position of the body, in profile, supported on one leg, with the other leg extended behind and at right angles to it. What is this position called?

answered Dec 7, 2024

1 answer 208k views

Why have critics argued that the clinical trial described in Reading 28 ("Social Context: Clinical Trials, HIV and Pregnancy: A Third World Tuskegee?") was unethical? Do you agree or disagree? (Assume

answered Nov 18, 2024

1 answer 144k views

The following sequence was taken from a DNA molecule: 5'- AACCTTTAGGGCCCTTTAAA - 3'. Given that the temperature required breaking one bond in the molecule is 12°C. What is the total temperature required

asked Sep 28, 2024

1 answer 126k views

The two angles on this straight line add up to 180°. Find the size, in degrees (°), of the larger angle. x+130° x+20

asked Sep 11, 2024

1 answer 75.7k views

Based on the illustration, if m∠7 = 51 degrees, what is m∠1? A. m∠1 = 51 degrees B. m∠1 = 61 degrees C. m∠1 = 145 degrees D. m∠1 = 129 degrees

asked Jul 17, 2024

1 answer 115k views

Trichuris vulpis of the dog, fox, and coyote can be found in the? 1) right ventricle and pulmonary arteries. 2) small intestine. 3) Stomach 4) Cecum

asked Jun 26, 2024

1 answer 51.9k views

Brock is budgeting his money. He wants to make sure he has a lot of healthy food, but also that he has some snacks as well. He decided for every $9.00 he spends on healthy food, he will spend $1.00 on

answered Jun 12, 2024

2 answers 49.5k views

12) An anion always A) has a positive charge. B) contains a group of two or more atoms with a positive charge. C) contains a metal and a nonmetal. D) forms covalent bonds. E) has a negative charge.

asked May 4, 2024

1 answer 80.8k views

User support expense budgets are often divided into two large categories: personnel and facilities? 1) True 2) False

answered Apr 27, 2024

1 answer 77.6k views

Remember the time when you were weak and low

answered Apr 19, 2024

1 answer 112k views

An examiner plans to collect samples for cytologic studies during a vaginal examination. Which is the recommended method for lubricating the speculum? A. A water-soluble lubricant B. Topical anesthetizing

answered Mar 31, 2024

1 answer 94.4k views

The Sun is directly overhead north of 23.5° north latitude twice a year a) True b) False

asked Mar 15, 2024

1 answer 11.8k views

When someone says that the wind direction today is south, does this mean that the wind is blowing toward the south or from the south? a) The wind is blowing toward the south b) The wind is blowing from

answered Mar 12, 2024

1 answer 10.0k views

An employee earns $ 25.74 per hour after receiving a 4 % raise. What was the employee's hourly pay before raise? Round your answer to the nearest cent.

answered Feb 14, 2024

2 answers 17.0k views

( long text essay ) submit your inventory of your favorite games, outdoor activities, and playthings. ( just pick random things please )

asked Feb 8, 2024

1 answer 170k views

What was referred to as the "Gold Coast"? O the East Coast American colonies O eastern South America O the Cape of Good Hope O West Africa

answered Feb 1, 2024

1 answer 117k views

Describe wave properties and give at least 2 examples of transverse waves and longitudinal waves.

answered Nov 14, 2023

1 answer 228k views

For the outsiders book, how are the greasers and socs alike

answered Oct 29, 2023

1 answer 106k views

Scientific notation of 5x 4 over 10

asked Oct 20, 2023

1 answer 12.2k views

Graph the function. g(x)=-x^2-6x-6

asked Oct 18, 2023

1 answer 64.2k views

Ask a Question