Recent activity by Brijesh Singh

Recent activity by Brijesh Singh

Which of the binomials below is a factor of this trinomial? x^2 + 12x + 36A. x+6B. x-4C. x+4D. x-6

answered Dec 21, 2023

1 answer 110k views

Original DNA: TACTTTAATCCCAAATTTACT DNA: TACTTTAATCCCAAGTTTACT mRNA: ? amino acid: ? what type of mutation is this: ?

answered Dec 19, 2023

1 answer 207k views

Find the midpoint of the line segment with the given points.

asked Dec 8, 2023

1 answer 218k views

If $a$ and $b$ are positive integers for which $ab - 6a + 5b = 373$, what is the minimal possible value of $|a - b|$?

answered Oct 27, 2023

1 answer 81.4k views

What’s the answer ?????

asked Oct 27, 2023

1 answer 97.3k views

The steam engine influenced the growth of the economy in the North. Which statement about the steam engine is false? It provided the main fuel needed to increase iron production. It powered factories when

asked Oct 20, 2023

2 answers 45.1k views

What is the square root of 121 ?

answered Aug 26, 2023

2 answers 109k views

5. Write the equation of the line in slope-intercept form given the following:Point (1, 4), slope6

asked May 27, 2023

1 answer 158k views

33) Given the graphs of f(x) = x - 1 and g(x) = -x - 7, what is the solution to the equation f(x) = g(x)? A)-1 B) - 3 C) - 4 D) - 7

answered Apr 19, 2023

1 answer 39.0k views

Which of the four triad types occursleast often in tonal music?

answered Feb 20, 2023

1 answer 142k views

7 students drew were 6, 4, 5, 7, and 8. What is the mean height of the triangles?

answered Dec 15, 2022

2 answers 227k views

Introduction to food chains and food webs

asked Dec 1, 2022

1 answer 168k views

In the following compound (HCl), can you please tell me the following: Is it an ionic or covalent compound? How many valence electrons does Hydrogen have? How many valence electrons does Chlorine have?

asked Nov 23, 2022

1 answer 194k views

What did the Soviet Union and Germany sign shortly before the official outbreak of World War II? What was the second part of that agreement?

answered Nov 21, 2022

1 answer 185k views

What do you have to do to become faster at running?

asked Oct 14, 2022

2 answers 91.8k views

Rewrite the polynomial in standerd form f(x)=(3x+1)(x+2)(x-3)

asked Sep 16, 2022

1 answer 172k views

Help me I really need this done

asked Aug 10, 2022

1 answer 220k views

James has x sweets. Tom has 5 more than James. Write an expression for the number of sweets Tom has. * O (1 Point)

asked Aug 9, 2022

2 answers 181k views

Does anyone know this

answered Jul 15, 2022

1 answer 28.4k views

Distinguish between the desktop publishing packages and multimedia packages

asked Jun 15, 2022

1 answer 188k views

Search QAmmunity.org