Recent activity by Bosco

Question

How many distinct pairs of positive consecutive integers have a product less than 10,000? Please explain it step-by-step

answered Nov 9, 2023

2 answers 163k views

Shelly rolls a dice 36 times. How many of those times should she expect it to land on a 1?

answered Oct 21, 2023

1 answer 59.2k views

What is the expression 1 in. = 2.54 cm properly (really) called?a.)equivalence statementb.)SI factor c.)conversion factorD.)equationits not conversion factor

answered Oct 20, 2023

1 answer 225k views

The Short-Run Macroeconomic Model is very similar to the standard model for markets. In what ways are these two models similar? A. no Demand Curve B. upward sloping Supply Curve C. downward sloping Supply

asked Jul 15, 2023

1 answer 59.1k views

Can someone give me good malls/stores that are located in Dominican Republic and why they are good places to shop at. I need some ideas rather than the articles I am reading, please help!

answered Jun 26, 2023

2 answers 74.5k views

EF is the median of trapezoid ABD. What is x?

asked Jun 11, 2023

2 answers 118k views

What number you can put without changing the value

answered Jun 1, 2023

1 answer 77.6k views

Which organism is responsible for cervical cancer? Marta is infected with a s8xually transmitted disease. Diagnosis reveals that she is infected with the -------------------, which causes cervical cancer.

answered Mar 23, 2023

2 answers 178k views

What reason does lady macbeth give for not killing king duncan herself?.

answered Feb 2, 2023

2 answers 200k views

Which two events are part of the rock cycle? O A. Carbon cycles between plants and animals. B. Plants take minerals from soil and grow. C. Melted rock cools and solidifies. D. Sediment is buried and compacted.

answered Dec 23, 2022

2 answers 49.4k views

How does ur bmi effect ur health what does obesity mean how does it effect u positive and negativity what are the causes and treatment

asked Dec 22, 2022

1 answer 184k views

A label for a drug indicates that each milliliter contains 3 milligrams of the drug. How many milligrams are in 9 milliliters?

answered Nov 23, 2022

1 answer 162k views

My teacher asked what are 4 concsutive days of the week so confuesd help

answered Nov 14, 2022

2 answers 73.1k views

Please help im very very desperate

answered Nov 14, 2022

2 answers 6.5k views

Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT HELP ME PLEASEEEEE !!

asked Jul 26, 2022

1 answer 20.7k views

Which of the following is true about personal property belonging to individuals and businesses? a. Individuals generally own more intangible property than businesses b. Only businesses generally own intangible

answered Jun 11, 2022

2 answers 138k views

Lydia Gomez has $185 deducted from her semimonthly pay for her group health insurance. Her employer pays 65% of the cost. What is the annual premium amount for Lydia's group health insurance?

asked Jun 9, 2022

2 answers 78.9k views

Write script for a play about an imag- inary meeting between Martin Luther and John Calvin. Think about what the two men may have discussed concerning their beliefs and how they differed.

answered May 23, 2022

1 answer 202k views

Translate the following weather reports into Spanish 1. Today it is good weather, it's hot, and sunny. 2. Normally in the spring it rains and it is cool. 3. In the winter it is generally bad weather, it

asked May 17, 2022

2 answers 223k views

A schedule helps students with time management. The predicate is O schedule O helps O management

asked Mar 23, 2022

1 answer 34.5k views

Ask a Question