Recent activity by Benoit Bertholon

Recent activity by Benoit Bertholon

When you are cold, your _____ system sends messages to your muscles to make you shiver.

answered Nov 30, 2024

1 answer 141k views

How do you think the presence of brown kelp in the Indian Ocean may affect the ecosystem in that location

asked Nov 15, 2024

1 answer 18.8k views

I need urgent help for #7!! (Geometry)

answered Oct 17, 2024

1 answer 88.6k views

The Columbia Sportswear Company corporate responsibility statement says, "Whether it is responsible sourcing, giving back to our communities, or reducing our environmental impact, we believe corporate

asked Oct 6, 2024

1 answer 7.2k views

B needs to hire 30 new employees. The hiring process has the following steps: 10% of applicants do not meet standards, 12% of the remaining applicants do not pass the pre-screening, 23% do not show up,

asked Sep 9, 2024

1 answer 161k views

(secondary structure)Secondary Structure The __-__ __ is an extended structure in which segments of the protein chain align to form a zigzag structure like a folded paper fan.

answered Sep 7, 2024

1 answer 220k views

Planned Parenthood v. Casey held that a state court could limit abortions as long as the regulation did not pose an undue burden on pregnant women. a) True b) False

asked Jun 8, 2024

1 answer 94.5k views

Estimate the sum of the decimals below by rounding to the nearest whole number. Enter your answer in the space provided. 7.176 8.586 + 5.698

answered May 21, 2024

1 answer 75.0k views

Which type of sedimentary rock forms from weathered sediment?

answered Apr 4, 2024

2 answers 95.0k views

Explain the roles of animal dropping and farm yard manure in an ecosystem

answered Mar 31, 2024

1 answer 150k views

Pedestrian traffic in the U.S. is characterized by all of the following except

answered Mar 24, 2024

1 answer 51.8k views

What is the value of y? y 60° 80°

asked Dec 23, 2023

1 answer 115k views

I need help with this geometry problem is for my study guide.

asked Oct 28, 2023

1 answer 225k views

What is true when a system of equations has no solution? The lines intersect in one place. The lines are parallel and do not intersect. The lines coincide (are the same line). This is impossible

answered Aug 19, 2023

2 answers 138k views

A picture of 4 Quadrants

asked Aug 2, 2023

1 answer 202k views

Which statement accurately describes the probability of genotype combinations in this Punnett square?

answered Jul 16, 2023

2 answers 219k views

1. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACATCCGCTTACGTCTGATCGCT 5' Type of mutation ( 3pts): Amino acid ( 3pts):

asked Jun 5, 2023

1 answer 37.7k views

Fossilized life forms which, according to Darwin, show a transition between one species and another are called... answer choices Distinct layers of rock Index fossils Intermediate links Transitional forms

asked Apr 19, 2023

1 answer 30.2k views

What diameter must a circular piece of stock be to mill a hexagonal shape with a side length of 2.7 in.?

answered Apr 3, 2023

1 answer 1.1k views

Play these games Pirate B00te and Delivery Drone Step 2: Analyze the Games After you have played the games, write one paragraph explaining the game’s objectives, operation, obstacles, and outcomes.

asked Mar 1, 2023

2 answers 130k views

Search QAmmunity.org