Recent activity by Benoit Bertholon

Recent activity by Benoit Bertholon

What is the value of y? y 60° 80°

asked Dec 23, 2023

1 answer 115k views

I need help with this geometry problem is for my study guide.

asked Oct 28, 2023

1 answer 225k views

What is true when a system of equations has no solution? The lines intersect in one place. The lines are parallel and do not intersect. The lines coincide (are the same line). This is impossible

answered Aug 19, 2023

2 answers 138k views

A picture of 4 Quadrants

asked Aug 2, 2023

1 answer 202k views

Which statement accurately describes the probability of genotype combinations in this Punnett square?

answered Jul 16, 2023

2 answers 219k views

1. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACATCCGCTTACGTCTGATCGCT 5' Type of mutation ( 3pts): Amino acid ( 3pts):

asked Jun 5, 2023

1 answer 37.7k views

Fossilized life forms which, according to Darwin, show a transition between one species and another are called... answer choices Distinct layers of rock Index fossils Intermediate links Transitional forms

asked Apr 19, 2023

1 answer 30.2k views

What diameter must a circular piece of stock be to mill a hexagonal shape with a side length of 2.7 in.?

answered Apr 3, 2023

1 answer 1.1k views

Play these games Pirate B00te and Delivery Drone Step 2: Analyze the Games After you have played the games, write one paragraph explaining the game’s objectives, operation, obstacles, and outcomes.

asked Mar 1, 2023

2 answers 130k views

Marsha deposited $12,000 into a savings account 5 years ago. The simple interest rate is 4%. How much money did Marsha earn in interest?

asked Dec 10, 2022

1 answer 81.5k views

The sum of N and the product 5 times n is 24. What is the value of n?

answered Dec 9, 2022

1 answer 17.5k views

There are 38 students involved in planning the homecoming parade of these students 15 are boys and 23 are girls if two members are selected to lead the parade what is the probability that both are girls

answered Dec 4, 2022

1 answer 66.0k views

PLS GUYS HELP!!!! Examine the table with the distances and times recorded for five different trains. Calculate the average speed for each train and select the correct answer choices. Select ALL that apply.

asked Nov 19, 2022

1 answer 77.0k views

Traduzca: The students will always do their homework. Los estudiantes siempre hagan su tarea. Los estudiantes siempre hacerán su tarea. Los estudiantes siempre harán su tarea. Los estudiantes siempre hacán

answered Oct 16, 2022

2 answers 22.9k views

A small box holds 60 books. A large box holds 135 percent as many as thaan a a small box how many books does the large box hold

answered Oct 13, 2022

2 answers 171k views

Fossil fuel dependence is associated with ______. Please select the best answer from the choices provided. A: environmental consequences B: economic consequences C: development hindrances D: all of

answered Aug 16, 2022

1 answer 155k views

I didn’t pay attention in class help

answered Aug 1, 2022

1 answer 147k views

What is the area of 3.46ft and 4ft

answered Jun 9, 2022

1 answer 162k views

Write an equation for the description. Ten times the sum of half a number x and 5 is 8.

answered Apr 24, 2022

1 answer 167k views

What is the name of the Egyptian sun god, usually depicted as a hawk-headed man with a solar disk and cobra on his head

asked Apr 21, 2022

2 answers 168k views

Search QAmmunity.org