Recent activity by Bdimag

Recent activity by Bdimag

QUESTION 4 For the following sentence, select how many adjectives there are: Several young children were playing near therbusy road, and it made me nervous.

answered Dec 15, 2023

1 answer 235k views

If the concentration of mercury in the water of a polluted lake is 0.200 μg (micrograms) per liter of water, what is the total mass of mercury in the lake, in kilograms, if the lake has a surface area

asked Dec 10, 2023

1 answer 184k views

Two jets leave an air base at the same time and travel in opposite directions. One jet travels 86 mi/h slower than the other. If the two jets are 2696 miles apart after 2 hours, what is the rate of each

asked Oct 3, 2023

1 answer 222k views

Coping with loss __________. a. happens all at once b. is a continuous process c. will help you to erase memories of those you have lost d. isn't crucial to recovery after a major loss please select the

answered Aug 15, 2023

2 answers 192k views

Which set of numbers could represent the lengths of the sides of a right triangle? 7, 9, 11 12, 18, 22 10, 15, 20 8, 15, 17

asked Jul 25, 2023

1 answer 67.9k views

How did the Enabling Act of 1933 affect politics in Germany?

asked Jun 3, 2023

1 answer 206k views

6n−8(n+4)= what? Please help me

asked May 3, 2023

2 answers 117k views

Which need did it’s colonies provide to Great Britain Grains and vegetables Skilled laborers Raw materials for manufacturing Manufactured goods

answered Jan 23, 2023

1 answer 231k views

Add the matrix given below. which of the following images shows the sum of the matrices?

answered Jan 22, 2023

1 answer 228k views

Based on the table, which of the following is an impact of British rule in India?

answered Oct 29, 2022

1 answer 97.7k views

NEED HELP ASAPPP The probability that a mature hen will lay an egg on a given day is 0.80. Hannah has 6 hens. Using the table, what is the probability that at least 2 of the hens will lay eggs on a given

answered Oct 13, 2022

2 answers 4.0k views

A 196 mL sample of a gas at 36°C and 864 torr is heated to 76°C and the pressure is allowed to drop to 400 torr. What volume will the gas occupy at these new conditions? Answer in units of mL. PLEASE HELP

asked Oct 9, 2022

1 answer 47.3k views

8y^-18 as a fraction

answered Oct 7, 2022

2 answers 177k views

In Mendel’s early experiments, what percent of the F1 generation expressed (showed) the dominant factor? Select one: a. 75 % b. 25 % c. 100 % d. 50 %

answered Oct 3, 2022

1 answer 121k views

Suppose you created a set of instruments using water and drinking glasses. You need a note with a very low pitch to complete a certain song—what should you do? Pour out some of the water in the glass with

asked Sep 9, 2022

1 answer 119k views

What is the first element in a typical plot

answered Aug 12, 2022

1 answer 35.4k views

योगमाया कस्तो समाजको खोजीमा लागिन्।

answered Jul 2, 2022

1 answer 49.8k views

1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids:

asked Jun 27, 2022

2 answers 93.6k views

What is the vertex of this absolute value function?

answered Jun 27, 2022

1 answer 57.7k views

M + 7 ≥ 20, if m = 11

asked Jun 25, 2022

1 answer 146k views

Search QAmmunity.org