Recent activity by Bassirou

Recent activity by Bassirou

The sides of a triangular plot are in the ratio 3 : 5 : 7 and its perimeter is 300 m. find its area

asked Dec 12, 2023

2 answers 165k views

Translating Equations Translate the sentence into an equation The product of a number and twelve is seventy-two. What steps would you take to translate the statement? Check all that apply. Replace the

asked Nov 9, 2023

2 answers 69.6k views

Valentina has a tray where she keeps all of her important papers. the tray is in the shape of a rectangular prism with no top. a rectangular prism with a length of 12 inches, width of 10 inches, and height

asked Nov 3, 2023

1 answer 50.5k views

< Question Calculate the median value of this data set. -12 9 -5 24 -33 17

answered Sep 23, 2023

1 answer 111k views

Jeremy can run 2 miles in 3/4 hours. At this rate, how many miles can he run in 5 hours

asked Aug 1, 2023

1 answer 7.2k views

What type of number is -47?Choose all answers that apply:AWhole numberBIntegerсRationalIrrational

asked Jun 13, 2023

1 answer 18.1k views

2x3-x2-2x+1 divided by 2x-1

answered Jun 6, 2023

2 answers 86.1k views

Why did hundreds of volunteers (many of them white, college students) go to mississippi in the summer of 1964?

answered Jan 23, 2023

1 answer 93.5k views

Please Please help me.

answered Dec 26, 2022

1 answer 194k views

Help me pleaseeeeeeeeeeee

answered Nov 9, 2022

1 answer 70.8k views

When discussing seismic waves, what are shadow zones? A) areas on a seismograph where data cannot be detected B) areas in the Earth's core that cannot be penetrated by the waves c) areas of the Earth shielded

answered Oct 2, 2022

2 answers 50.8k views

The diagram shows the process of cell differentiation. Which statement is true about the process shown? A Cell 1 has a specific part of its DNA activated. B Cell 2 undergoes a process to become a specialized

asked Sep 3, 2022

1 answer 113k views

Which inequality represents this statement? A number is at least 12. n>12 n≥12 n<12 n≤12

asked Aug 15, 2022

1 answer 217k views

PLZ help me I’m too slow

answered Jun 24, 2022

1 answer 163k views

Gerald Roberts has already finished his pattern for a pajama; he wants to add an allowance for cutting what tall will he need to use to measure the allowance? A.Seam Gauge B.Pins C.Ruler D.Tape Measure

asked Jun 15, 2022

2 answers 146k views

Please help!!!!! pls pls pls

answered Jun 13, 2022

1 answer 132k views

Help please is answer A or B?

answered May 23, 2022

1 answer 167k views

Please help me out lolll

asked May 15, 2022

2 answers 55.8k views

What is the complementary strand of DNA to the one below? AAACCGTATCCGCGGTATATCGCCGGAAT

answered Mar 26, 2022

2 answers 55.2k views

50 POINTS! false answers will be reported and u wont get points Can a solution to this equation be 3, because then both sides would have divide by 0?

answered Feb 28, 2022

2 answers 32.3k views

Search QAmmunity.org