Recent activity by Arnis Lapsa

Question

Write the function in the form y=f(u) and u=g(x). Then find d y/d x as a function of x. y= ⁴ x u=__

asked Sep 16, 2024

1 answer 110k views

Extensive training is target scarch can lead to a. Varied mapping b. Serial search c. Degraded performance d. Automaticity? 1) Varied mapping 2) Serial search 3) Degraded performance 4) Automaticity

answered Jul 31, 2024

1 answer 52.4k views

7-7 Common stock value-Zero growth Kelsey Drums, Inc., is a well-established supplier of fine percussion instruments to orchestras all over the United States. The company's class A common stock has paid

asked Jul 11, 2024

1 answer 42.5k views

What do you predict will happen in Act IV, the final act? AND What suggestions do you have for research topics based on The Crucible?

answered Jun 29, 2024

1 answer 36.0k views

An electron with kinetic energy (KE) of 24.5 cV moves into a region of uniform magnetic field B of magnitude 4.45 x 10 5 T. The angle between the direction of B and the electron’s velocity =(cp) is 65.

asked Jun 16, 2024

1 answer 12.3k views

An analytical chemist weighs out 0.218 g of an unknown triprotic acid into a 250 ml volumetric flask and dilutes to the mark with distilled water. she then titrates this solution with 0.0800 m naoh solution.

asked May 17, 2024

1 answer 189k views

On December 31, 2020, Coolwear, Inc. had a balance in its prepaid insurance account of $54,400. During 2021, $92,000 was paid for insurance. At the end of 2021, after adjusting entries were recorded, the

answered May 2, 2024

1 answer 221k views

36 miles per hour converted to miles per second

asked Apr 12, 2024

2 answers 190k views

A continuity mis-match in which the rules of continuity editing are deliberately violated in order to disorient the spectator. Often done to call attention to the cinematic medium. Classic examples can

asked Apr 1, 2024

1 answer 195k views

Consider this DNA sequence: TTCGAATTCGACTCAGGATCCTACAAGTTTGAT AAGCTTAAGCTGAGTCCTAGGATGTTCAAACTA Which of the following restriction sites are present in this sequence? 1) EcoRI 2) HindIII 3) BamHI 4) NotI

asked Mar 19, 2024

1 answer 123k views

Let w=2+i and z be nonzero complex number. If the argument of z is pi/4 and |x-w| =sqrt(5) , what is | z |^2

answered Feb 28, 2024

1 answer 179k views

Alguien tiene buenas canciones. informe a

answered Dec 8, 2023

2 answers 158k views

Use the distrubutive property to simply (2-5m)(-5)

asked Jul 25, 2023

1 answer 191k views

Scrooge meets the Ghost of Christmas Present in Act II of A Christmas Carol: Scrooge and Marley. Which of the following statements that Scrooge makes to Present shows most clearly that Scrooge has begun

asked Jul 8, 2023

1 answer 147k views

An elderly woman purchases a table from a local furniture store for $5,000. She decides that she does not want the table because of a defect. The woman successfully cancels the payment on the credit card

asked Jun 16, 2023

1 answer 58.0k views

Dhswer in the 4. Leela delivers newspapers every Saturday. She earns $3 for every 10 deliveries. She earns an extra $7.00 after every 50 deliveries. How much will Leela earn if she delivers to 100 homes

answered Jun 16, 2023

1 answer 223k views

In Figure 1.1, what is the measure of e? (Explain)

asked Jun 11, 2023

1 answer 86.3k views

Select two numbers that multiply together to make 1 million. 40 A 2,000 B 5,000 C 25,000 D

answered May 11, 2023

2 answers 42.3k views

During what time interval should the camera be turned on in order to preserve battery power when the camera is too distant to be used. (College precalc- nonlinear inequalities).

asked May 4, 2023

1 answer 195k views

In binary fission, one cell reproduces into _____ cell(s).(1 point) Responses four four three three two two one

asked Apr 10, 2023

2 answers 28.2k views

Ask a Question