Recent activity by Anton Baksheiev

Recent activity by Anton Baksheiev

Find the sine, cosine, and tangent of angle A. Give your answer as a fraction in simplest form I need help

answered Dec 17, 2023

1 answer 124k views

The main benefit of GPS technology is that it can — A. remove salt from drinking water B. calculate population density C. predict population growth in urban areas D. track the location of objects

answered Nov 26, 2023

1 answer 155k views

A right triangle has an area of 364.5cm^2. If its base is 27cm then whats the height?

answered Nov 13, 2023

1 answer 172k views

What is the area, in square inches, of the shape below? Express your answer as a fraction in simplest form.

answered Oct 26, 2023

2 answers 45.1k views

Which is an example of a group of cells with a common structure and function?StomachMuscle tissueMitochondriaNucleus

asked Sep 27, 2023

1 answer 210k views

How did the 14th and 15th Amendments affect women?

asked Sep 2, 2023

1 answer 215k views

This is english. which of these is an example of graphic? a. introduction b text box with summery points c. paragraphs d. clincher sentence

answered Jul 16, 2023

2 answers 105k views

In January Caleb could do 12 pushups. In May Caleb could do 15 pushups. By what percent did he increase the number of pushups he could do?

asked Jun 5, 2023

2 answers 184k views

Why is it important for healthcare professionals to be self-aware and examine their own culture and personal beliefs? A. to be more sensitive to patients and coworkers from their own culture B. to be more

answered Jun 5, 2023

2 answers 153k views

Aaron claims the same answer could also be found by adding either –5 3 or –3 5. what is the error in aaron’s reasoning? the commutative property is not true for addition. the negative signs were switched.

asked Jan 23, 2023

1 answer 109k views

What is the mRNA in TACCGGATGCCAGATCAAATC?

answered Nov 18, 2022

1 answer 173k views

VIDEO LINK CLICK HERE 1. We often think of pain as a negative thing and might imagine a pain-free world as something wonder illustrate how pain is “useful"? Why is pain adaptive? 2. How could a child with

asked Oct 22, 2022

1 answer 136k views

22. After paying $7.50 for a movie ticket, Salvador still had $3.75. How much money did Salvador have before paying for a ticket?

answered Oct 3, 2022

1 answer 148k views

A quadrilateral has 2 pairs of parallel sides and no right angles what two shapes can it be

answered Sep 23, 2022

1 answer 210k views

A toy store markets down every toy by 15% in January.How much does a toy cost during January?

asked Sep 18, 2022

1 answer 155k views

Explain the word earth(short paragraph)

answered Sep 4, 2022

2 answers 79.1k views

7. Find the range of {(3.2, –3), (7.6, 5.9), (1.4, –3), (–9.1, 8.3)}. A. {–3, 1.4, 3.2} B. {–3, 5.9, 8.3} C. {–9.1, 1.4, 3.2, 7.6} D. {–9.1, 5.9, 7.6, 8.3}

answered Aug 19, 2022

1 answer 51.6k views

What does it show you or help you to understand about this time ?

asked Jul 6, 2022

1 answer 68.6k views

Solve -4m(3n-6p) in distributive Property

answered Jun 27, 2022

2 answers 63.3k views

Help me please!!! I’m timed

asked May 24, 2022

2 answers 8.6k views

Search QAmmunity.org