Recent activity by Alvin Konda

Recent activity by Alvin Konda

How many basic notes does the country of Pakistan usually have ?

answered Nov 13, 2023

1 answer 103k views

Why drove the U.S. to act like an imperialist nation? please someone can help me quickly

answered Jul 31, 2023

2 answers 82.5k views

One ounce of yogurt contains 1.2 grams of sugar. How many grams of sugar are in 14.25 ounces of yogurt?Group of answer choices0.171 grams1.71 grams17.1 grams171 grams

answered Jul 22, 2023

1 answer 207k views

Twenty- one young men got a quote for the cost of a car insurance policy. The policy and ages of the men are shown in the scatter plot.

answered Jul 16, 2023

1 answer 22.8k views

Which number added to -1 gives the sum of 0?

answered Jun 14, 2023

1 answer 14.8k views

The price of a car that was bought for $20,000 and has depreciated 8% yearly. Which equation will help find the value of the car after a certain period of time? What is the value of the car 5 years later?

asked Apr 26, 2023

1 answer 34.5k views

What is true love...?

answered Apr 11, 2023

2 answers 23.3k views

One of the reasons the colonists moved from England to North America was to pursue religious freedom. A. True B. False

answered Jan 13, 2023

1 answer 130k views

What is 1/4 of 60?? please someone!!

answered Jan 8, 2023

1 answer 47.4k views

Find the new number given the Original number and the percent of change

answered Nov 14, 2022

2 answers 144k views

Lieutenant James made an average of 3 arrests per week for 4 weeks. How many arrests does she need to make in the fifth week to raise her average to 4 arrests per week?

answered Oct 17, 2022

2 answers 201k views

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT

answered Oct 9, 2022

1 answer 29.4k views

The normal distribution is

asked Oct 7, 2022

1 answer 3.6k views

1. What is the theory of Status and Role? 2. What is something transcendental?

asked Oct 6, 2022

1 answer 176k views

What are 2 stages of photosynthesis, and where does it take place?

asked Jul 27, 2022

1 answer 14.2k views

Say what people are doing when the weather changed 1. on/écouter de la musique dans le parc/quand il a commencé à pleuvoir 2. les enfants/porter une veste d'automne/quand il a commencé à neiger 3. Sandrine

answered Jul 5, 2022

2 answers 204k views

XYZ Corporation manufactures air conditioners and has the capacity to manufacture and sell 80,000 units each year. It is currently only manufacturing and selling 60,000 units. The following per unit numbers

answered Jun 27, 2022

1 answer 296 views

The distance between two towns is 120 kilometers. There are approximately 8 kilometers in 5 miles. How many miles apart are the two towns?

answered Jun 26, 2022

1 answer 194k views

What does priortize means

answered Jun 14, 2022

2 answers 35.4k views

Help!!! Thank you Math xl

answered Jun 11, 2022

1 answer 150k views

Search QAmmunity.org