Recent activity by Aeskr

Question

How much heat in calories is needed to take a 49.3-gram block of ice from -22.2o to 22.2o?

answered Dec 17, 2024

1 answer 166k views

The classic sign of placenta previa is the sudden onset of ___________ uterine bleeding in the latter half of pregnancy. a. Spotting b. Heavy c. Painful d. Pain-free

asked Dec 8, 2024

1 answer 41.7k views

If Q is displayed fourth, then R must be displayed second. R and S are displayed consecutively. a) True b) False

asked Dec 3, 2024

1 answer 80.3k views

Question 1 of 10 What can a poet use to help establish the mood of a poem? O A. Theme OB. Imagery O C. Denotation O D. Rhythm

asked Sep 3, 2024

1 answer 4.0k views

which would you measure in kilograms? (1 point) the mass of a butterfly, the capacity of a bottle, the mass of a basketball, the length of a river

asked Jun 3, 2024

1 answer 62.5k views

Write a short paragraph about a job you dream to do in the future

answered Apr 1, 2024

1 answer 66.8k views

In the short run, the relationship between inflation and unemployment can be most accurately described by saying: a) They have a positive correlation b) They have a negative correlation c) They are unrelated

asked Feb 9, 2024

1 answer 180k views

Which of the following statements is true regarding the time-driven activity-based costing (ABC) system? a. It is an approach that uses expected consumption ratios to reduce the number of cost drivers.

asked Jan 16, 2024

1 answer 1.6k views

Which member of the IDT assists nurses with care, specifically activities of daily living (ADLs)? A. Doctor B. Dietician C. Certified Nursing Assistant (CNA) D. Speech Pathologist

asked Jan 10, 2024

1 answer 44.3k views

Según andrés, paula y él lo pasaron bien. Cierto falso andrés piensa que paula es demasiado tímida. Cierto falso andrés quiere salir otra vez con paula. Cierto falso andrés tiene celos porque josé luis

asked Nov 1, 2023

1 answer 234k views

Each pencil costs $1.20 how much would 2 pencils be

answered Oct 15, 2023

1 answer 171k views

What type of chromosomes determine organism? the gender of an A. binary B. sex this C. autosomal

answered Jul 22, 2023

2 answers 176k views

The evolutionary process by which the best-adapted individuals of a species survive and reproduce is called ______ selection.

asked Jun 17, 2023

1 answer 46.5k views

1. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACATCCGCTTACGTCTGATCGCT 5' Type of mutation ( 3pts): Amino acid ( 3pts):

answered Jun 11, 2023

1 answer 37.7k views

A summary should include an opinion of the text. both major and minor details of a text. only the central ideas of a text. mostly quotes from the text.

asked Mar 8, 2023

1 answer 152k views

How far away is {-4,-6} away from {5,-6} on a coordinate grid

asked Feb 9, 2023

1 answer 143k views

Consider the functions f(x) = (x - 5)2 + 2 and g (x) = (x + 6)2 - 4. Which of the followstatements is true?The graph of g (x) is shifted 2 units below and one unit to the right to the graph of f(x).The

asked Jan 10, 2023

1 answer 31.5k views

REWITE THE COMPLETE SENTENCE WITH CORRECT PUNCTUATION!! When she is shopping for clothes, Marcie never buys more than two items at a time.

asked Dec 9, 2022

2 answers 158k views

What does bivariate mean? Favorite tik.tok dance? lol..

answered Dec 9, 2022

2 answers 108k views

8. We know Romeo and Juliet got married, but many other characters do not. a. Dramatic Irony b. Situational Irony c. Verbal Irony d. Figurative Irony NO LINK please

asked Nov 3, 2022

2 answers 147k views

Ask a Question