Recent activity by Ady Ngom

Recent activity by Ady Ngom

Which of the following contributes to the theme? A. The real tree is more detailed and smells fresher than the plastic trees that line the streets. B. The inside tour of the O'Brien home is not as impressive

answered Nov 24, 2023

2 answers 148k views

In python Simple geometry can compute the height of an object from the object's shadow length and shadow angle using the formula: tan(angleElevation) = treeHeight / shadowLength. Given the shadow length

asked Nov 4, 2023

1 answer 161k views

K Find the production matrix for the following input-output and demand matrices using the open model. A = 0.3 0.2 0.35 0.4 3 -[³] 6 D= The production matrix is (Round the final answer to the nearest hundredth

asked Oct 1, 2023

2 answers 167k views

A sum of c and 12 divided by 3

asked Sep 14, 2023

1 answer 56.8k views

MULTIPLE CHOICE Question 2 Look at the drawing below. Which of the following statements, if true, would alone prove pllq? Select all that apply. There are at least two correct answers.

asked Jun 20, 2023

2 answers 210k views

Decide which statement gives the theme of each passage. Drag each statement to the correct passage. 1: We should learn new ways to have fun in the places we live. 2: We should be thankful for the places

asked May 9, 2023

1 answer 72.4k views

The point (−7, 4) is reflected over the line x = −3. Then,the resulting point is reflected over the line y = x. Whereis the point located after both reflections?

asked Apr 25, 2023

1 answer 211k views

How to solve this limit problem?

answered Apr 18, 2023

1 answer 199k views

What is 1,267 divided by 3

answered Mar 20, 2023

1 answer 7.3k views

The contrast of the white print on the red background is most designed to .

asked Jan 10, 2023

1 answer 105k views

PLEASE HELP!!! 2 + x + x + x = 4x The equation has infinite solutions right?

asked Dec 17, 2022

1 answer 1.4k views

PLZ HELP AND UWU A baseball collector took inventory of all of his baseball cards along with the value of each card. The box plot represents the values of the cards in his collection. What percentage of

answered Dec 2, 2022

2 answers 225k views

The height of a vase is 6.2 feet when rounded to the nearest tenth of a foot. What is the shortest possible height of the vase? Give your answer to 3 decimal places. Plzzzzzzzzzz help me!

asked Oct 1, 2022

2 answers 35.6k views

Find the absolute value |-7|

answered Aug 9, 2022

2 answers 95.0k views

You 12. Choose one famous MLK quote as Favorite and explain why that is your favorite?

answered Aug 1, 2022

1 answer 111k views

HELP ME QUICKLY PLEASE! JUST ANSWERS! NO EXPLANATION NEEDED!!!!!!!!! I PUT IT DOWN AS 50 POINTS!!!!!!!!

answered Jul 30, 2022

2 answers 72.9k views

Please help I don’t understand

asked Jun 2, 2022

1 answer 130k views

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following

asked May 18, 2022

1 answer 10.2k views

Which claim best responds to the writing prompt? Imagine that you are trying to convince your family to get a pet for the first time. Decide what type of pet you would like, and write a letter to your

answered May 6, 2022

2 answers 60.4k views

Which of the following countries is not located near China? a.Egypt b.India c.Japan d. Korea

asked May 4, 2022

1 answer 11.9k views

Search QAmmunity.org