Register
Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: CGATACAATGGACCCGGTATGCGATATCC
180k views
3 votes
Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide

chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

User Pseudonymous
by
4.7k points

2 Answers

4 votes
C=G A=T dont know the rest have a gcodocododd dday
User MADMap
by
4.8k points
3 votes
I don’t feel like answering all that but....
C=G G=C T=A A=U
User Areg Sarkissian
by
5.2k points
Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

5.2m questions

6.7m answers

Other Questions

An example of the interaction of the nervous and endocrine systems can be seen in our response to danger. The _______________ orders the adrenal glands to release the hormones epinephrine and norepinephrine,
When an individual stops breathing, brain cells die very quickly, but the cells in the heart are able to survive for longer. Which conclusion is best supported by these facts?
Greg has been given a small sample of metal. His teacher has assigned him to identify what type of metal he was given. Which of the following is a physical property that will help Greg to identify the
What is the average speed of a biker that travels 50km in 5hrs?
Charles Darwins observation adventures of different species on the Galapagos islands have many similar physical characteristics supports the hypothesis hypothesis that these finches
Link Copied!