Question

Coding of a Polypeptide by Duplex DNA The template strand of a segment of double-helical DNA contains the sequence (59)CTTAACACCCCTGACTTCGCGCCGTCG(39) (a) What is the base sequence of the mRNA that can be transcribed from this strand

Answer 1

GAAUUGUGGGGACUGAAGCGCGGCAGC

Step-by-step explanation:

The process whereby a mRNA molecule is formed from a DNA template is called TRANSCRIPTION. The mRNA formation follows the complementary base pairing rule which says that Adenine is bonded to Thymine (Uracil in RNA) i.e A-T(U) while Guanine is bonded to Cytosine i.e. G-C.

Based on this, a DNA molecule with base sequence: CTTAACACCCCTGACTTCGCGCCGTCG will be transcribed into a mRNA strand with base sequence: GAAUUGUGGGGACUGAAGCGCGGCAGC