A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

asked Nov 20, 2021 62.7k views

3 votes

5.6k points

Please log in or register to add a comment.

5 votes

Answer:

TAAGCCGATAAATGCTAACGGTA

Step-by-step explanation:

A pairs with T

G pairs with C

vise versa

Zauberfisch answered Nov 26, 2021

5.8k points

Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

6.6m questions

8.8m answers