Register
What is the correct numerical sequence for unlocking "DNA Structure?"
74.0k views
22 votes
What is the correct numerical sequence for unlocking "DNA Structure?"

User Cameron Martin
by
3.7k points

1 Answer

10 votes

Answer:

3'TGACGACTACAACTTAATCT

Step-by-step explanation:

Adenine bonds with thymine; guanine bonds with cytosine. This is the complement DNA sequence.

User Kreisquadratur
by
4.0k points
Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

4.5m questions

5.9m answers

Other Questions

What are organic molecules made of?
The suns pole reveal are tied to its_
What process is shown in the diagram below? 1Points A drawing showing chromatids. Each member of the pair has a piece of the other one attached to it. A mitosis B crossing-over C metaphase D centrioles
How many chromosomes pairs are found in human cell
What is the function of the; Cell membrane: cytoplasm: Nucleus: cell wall: chloroplasts: vacuole: 15 points available
Link Copied!