17.3k views
5 votes
Restriction digest A:

ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC

How many bases are in the second fragment?

1 Answer

4 votes

Answer:

This question seem incomplete

Step-by-step explanation:

This question seem incomplete. However, if the strand of the second fragment is what is provided above, then the answer is 51

This strand/fragment is definitely a DNA strand because of the absence of uracil (U) or because of the presence of thymine (T). The four bases in a DNA are adenine (A), Thymine (T), cytosine (C) and Guanine (G). These bases also bind to one another in the pattern described below

A ⇆ T

G ⇆ C

Hence, the adenine (A) on one strand can only bind to thymine (T) on the complementary strand (and vice versa) while the guanine (G) on one strand can only bind to cytosine (C) on the complementary strand (and vice versa).

Hence, the letters seen is the question are representations of bases in a DNA strand/fragment. The number of letters/bases here are 51

User Kartikay Khanna
by
6.7k points