Register
4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please
36.3k views
1 vote
4. Translate the following RNA sequence into a protein chain.

AUGGUUACCAGUCGCUUAUAA
Please

User Gogogadgetinternet
by
4.4k points

1 Answer

1 vote

Answer:

AUUUAAAHAHYAGHY

Step-by-step explanation:

User Yujean
by
4.1k points
Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

4.5m questions

5.9m answers

Other Questions

Which of the following aqueous solutions are good buffer systems? . 0.29 M perchloric acid + 0.15 M potassium perchlorate 0.16 M potassium acetate + 0.26 M acetic acid 0.18 M hydrofluoric acid + 0.12 M
Suppose a flask is filled with of , of and of . The following reaction becomes possible: The equilibrium constant for this reaction is at the temperature of the flask. Calculate the equilibrium molarity
What mass of 2-naphthol would have to be ingested by each rat in a sample set of rats in order to kill half the population of rats? Assume each rat weighs 230 g. Show your calculations for full credit.
1. If temperature is increased, the number of collisions per second do what
A helium balloon containing 0.100 mol of gas occupies a volume of 2.4 L at 25 C and 1.0 atm. how many moles have we added if we inflate it to 5.6 L?
Link Copied!