Is the below sequence DNA or RNA? How do you know? GTTTACAGGCGGCGCAATATCTGATCG

asked Apr 1, 2021 205k views

1 vote

Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

7.6k points

Please log in or register to add a comment.

3 votes

The answer is DNA I know because I know

Soloidx answered Apr 2, 2021

7.5k points

2 votes

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

8.4k points

Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

9.5m questions

12.2m answers