Register
Write the complementary sequence to following DNA strand: AATTGCGATCGCTCGTACCGG
24.5k views
0 votes
Write the complementary sequence to following DNA strand: AATTGCGATCGCTCGTACCGG

User Hendrixski
by
5.5k points

1 Answer

4 votes

Answer:

TTAACGCTAGCGAGCATGGCC

Step-by-step explanation:

A and T pair together, and G and C are pairs. Whenever you see one of them in the original sequence, you'd just write the other one for the complementary sequence.

User MKay
by
5.6k points
Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

5.9m questions

7.7m answers

Other Questions

Which of these structures is primarily responsible for the enzymatic breakdown of a large molecules in the cell?
What are some common signs and symptoms of mental health disorders?
Which statement BEST describes the relationship between adenosine diphosphate (ADP) and adenosine triphosphate (ATP)? A. With an input of energy, ADP rearranges to become ATP. B. Without any energy change,
A state of joyful activity in which the subject performs an action effortlessly and skillfully is known as a(n) __________.
!! Earth Science!! Carbon dioxide is normally approximately 2% fraction of the air in the atmosphere. The reason carbon dioxide is considered a pollutant is because... a) Carbon dioxide levels are much
Link Copied!