152k views
4 votes
Task 1

In this task you will analyse an RFLP in order to determine which family members carry an inherited genetic trait. This variant is thought to cause cheek dimples! The DNA sequence analysed is as follows

Normal
5΄-ATGTGCTGGATGACAGATGTCGACCACCCATGTAGTTGTGTAGACCCCCCAGT-3΄

Variant
5΄-ATGTGCTGGATGACAGATATCGACCACCCATGTAGTTGTGATACCCCCCCAGT-3΄

The restriction enzyme that was used in the analysis is called EcoRV and it recognises and cuts the following sequence 5΄GATATC 3΄.

The following family members were tested:
1. Maternal grandmother
2. Paternal grandmother
3. Paternal grandfather
4. Mother
5. Father
6. Child A
7. Child B
8. Child C

Below is the agarose gel electrophoresis results following the RFLP analysis.

1 2 3 4 5 6 7 8









(Note: the banding patterns for family members 1,2 and 4 are the same, and banding pattern for family members 3, 5, 6 and 7 are the same.)

Questions

a. Looking at the two versions of DNA, the normal and the variant, explain which one you expect to be restricted by the enzyme. (2 marks)
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________

b. Give the affected family members and explain you answer. (5 marks)
__________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________

c. Hypothesise why the banding pattern for child C shows three bands. (2 marks)
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________

d. Which feature of DNA allows for its movement through an agarose gel when an electric current is applied? (1 mark)
___________________________________________________________________________

e. What is the reason for this feature in DNA? (1 mark)
___________________________________________________________________________



f. If the following sequence was restricted by the above enzyme, how many bands would appear on the gel? Explain your answer. (3 marks)

5΄ TGTCACTGATCGTCAGATGATATCACTGGTCCCAATCTGATC 3΄

___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________

g. In the diagram showing the DNA sequence above, what is the strand that is not shown called and what is the direction of this strand? (2 marks)
___________________________________________________________________________

h. Is it important to always show this missing strand in diagrams? Explain your answer. (2 marks)
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________

i. Give a reason for why RFLP analysis is not as commonly used anymore for such analysis and give one technique that has replaced it. (2 marks)
__________________________________________________

User Agorenst
by
8.4k points

1 Answer

3 votes
Om said that he had a lot more than a little more money than his wife and I was in the middle of a meeting with the guy that was going through the house and I had to go back and forth with him
User OscarTheGrouch
by
8.2k points