Register
AAAAAUGACCAAAGUGGAGUAAUGGUAACCC please type first 3 letters of each amino acid separated by a dash.
118k views
4 votes
AAAAAUGACCAAAGUGGAGUAAUGGUAACCC please type first 3 letters of each amino acid separated by a dash.

User Randakar
by
3.2k points

1 Answer

6 votes

Answer:

what?

Step-by-step explanation:

User Cplotts
by
3.3k points
Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

3.3m questions

4.2m answers

Other Questions

Gibberellic acid stimulates the cells of germinating grass seeds to produce mrna molecules that code for hydrolytic enzymes. In this case the role of gibberellic acid can best be described as that of
Name three ecosystem services provided by biodiversity.
As in most areas of biology, the study of mitosis and the cell cycle involves a lot of new terminology. Knowing what the different terms mean is essential to understanding and describing the processes
Climate change is a ___ environmental change
Cerebral aneurysm is most frequently the result of a. subarachnoid hemorrhage. b. subdural hemorrhage. c. meningitis. d. embolic stroke.
Link Copied!