Question

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include

Answer 1

To accurately revise the computer model for showing DNA transcription, the researcher should create a complementary mRNA sequence that matches the template DNA strand by using uracil (U) wherever adenine (A) would pair, and otherwise keeping the base pairing consistent with DNA replication rules.

Step-by-step explanation:

The scientific process of constructing an mRNA molecule from DNA is known as transcription. To revise the computer model to show transcription from the given DNA sequence, the researcher should include an mRNA sequence that is complementary to one of the DNA strands. As per the rules of base pairing, adenine (A) pairs with uracil (U), cytosine (C) pairs with guanine (G), guanine (G) pairs with cytosine (C), and thymine (T) pairs with adenine (A). Therefore, for the given DNA sequence, the complementary mRNA sequence would be UUGGACCGGUACCUGGAAUAAUAUUUGAUCCUA. This accounts for the replacement of thymine (T) with uracil (U) in the mRNA.

Transcription begins when the DNA double helix unwinds and RNA polymerase builds the mRNA using one of the DNA strands, known as the template strand, as a guide. As a result, the new mRNA strand will have a sequence complementary to the template strand and identical to the coding strand of the DNA, except that uracils (U) are present in place of thymines (T). This is critically important to model correctly, as the mRNA is later used in the protein synthesis process during translation.