Register
Determine the mRNA and amino acid sequence for the below DNA sequence.
219k views
5 votes
Determine the mRNA and amino acid sequence for the below DNA sequence.

Determine the mRNA and amino acid sequence for the below DNA sequence.-example-1
User Shashank Shah
by
6.0k points

1 Answer

3 votes
AUGAGCCCCGCUAGGUUCUC
User Arimbun
by
6.4k points
Ask a Question
Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

6.5m questions

8.6m answers

Other Questions

Milicent finds a plant in her backyard. It is tall and has large cones. What did Milicent find?
I need biology help. We are taking one lesson today and we need to make a habitat demonstration. It needs to show one habitat, 5 animals in that habitat, 5 plants in that habitat, and 5 sun drawings in
there are 3 different ways for plates to interact with eachother list the 3 types of faults and what they do
7. dinoflangellates stores excess sugar as A. proteins B. fats C. starch D. none of the above 8. An amoeba moves by extensions of its cytoplasm, which is know as A. cilia B. flagella C. pseudopdia D. none
Help me please!! 60 points! All three, please.
Link Copied!