T A A C G C A G What is the order of bases that will compliment this side of a DNA strand - QAmmunity.org

T A A C G C A G What is the order of bases that will compliment this side of a DNA strand

asked May 9, 2022 173k views

1 Answer

← Prev Question Next Question →

Related questions

asked Dec 21, 2024 97.8k views

What is the compliment mrna strand to the following dna strand? tat-tag-att-aca a) tat-tag-att-aca b) ata-atc-taa-tga c) utu-utc-tuu-tgt d) aua-auc-uaa-ugu

Rabea asked Dec 21, 2024

by Rabea

8.8k points

1 answer

0 votes

97.8k views

asked Apr 24, 2024 226k views

What code would be the compliment for this strand of DNA ACC TAC GGA TCC

Dave Mulligan asked Apr 24, 2024

by Dave Mulligan

8.3k points

1 answer

5 votes

226k views

asked Jan 10, 2019 131k views

What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT

Tirza asked Jan 10, 2019

by Tirza

7.3k points

1 answer

1 vote

131k views

Search QAmmunity.org