What is the complementary DNA of TACCGGATGCCAGATCAAATC?

DrMcCleod asked Apr 16, 2022

31,708 views

24 votes

DrMcCleod asked Apr 16, 2022

2.8k points

Your comment on this question:

Email me at this address if a comment is added after mine:Email me if a comment is added after mine

Privacy: Your email address will only be used for sending these notifications.

Email me at this address if my answer is selected or commented on:Email me if my answer is selected or commented on

Privacy: Your email address will only be used for sending these notifications.

22 votes

Answer:

ATGGCCTACGGTCTAGTTTAG

Step-by-step explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary DNA strand.

Davejohnson answered Apr 22, 2022

3.0k points

Email me at this address if a comment is added after mine:Email me if a comment is added after mine

Privacy: Your email address will only be used for sending these notifications.

Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

1.6m questions

2.0m answers