AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Kenny John Jacob asked Jan 13, 2022

180,181 views

11 votes

Kenny John Jacob asked Jan 13, 2022

3.0k points

Your comment on this question:

Email me at this address if a comment is added after mine:Email me if a comment is added after mine

Privacy: Your email address will only be used for sending these notifications.

Email me at this address if my answer is selected or commented on:Email me if my answer is selected or commented on

Privacy: Your email address will only be used for sending these notifications.

9 votes

Answer:

look at explanation

Step-by-step explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

Naseeba C answered Jan 18, 2022

2.8k points

Email me at this address if a comment is added after mine:Email me if a comment is added after mine

Privacy: Your email address will only be used for sending these notifications.

Welcome to QAmmunity.org, where you can ask questions and receive answers from other members of our community.

1.6m questions

2.0m answers